Mutagenetix > Incidental Mutation

Incidental Mutation 'R0961:Aox2'

81851

Institutional Source

Beutler Lab

Gene Symbol

Aox2

Ensembl Gene

ENSMUSG00000079554

Gene Name

aldehyde oxidase 2

Synonyms

Aox3l1

MMRRC Submission

039090-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.064) question?

Stock #

R0961 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58278326-58380259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58310071 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 665 (D665E)

Ref Sequence

ENSEMBL: ENSMUSP00000110006 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114366]

AlphaFold

Q5SGK3

Predicted Effect

probably benign
Transcript: ENSMUST00000114366
AA Change: D665E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: D665E

Domain	Start	End	E-Value	Type
Pfam:Fer2	13	83	3.4e-9	PFAM
Pfam:Fer2_2	92	166	4.2e-30	PFAM
Pfam:FAD_binding_5	241	421	5.1e-46	PFAM
CO_deh_flav_C	428	532	1.4e-23	SMART
Ald_Xan_dh_C	604	707	4.64e-47	SMART
Pfam:Ald_Xan_dh_C2	717	1251	1.3e-178	PFAM
low complexity region	1257	1271	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161126

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 95.6%
20x: 89.7%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	A	C	2: 151,472,766	S331A	probably benign	Het
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4933412E24Rik	T	C	15: 60,015,311	I427V	probably benign	Het
Abca15	A	T	7: 120,360,985	K664*	probably null	Het
Adcy8	A	G	15: 64,754,862	V709A	possibly damaging	Het
Arhgap22	C	T	14: 33,367,113	T352M	probably damaging	Het
Atg9a	G	A	1: 75,186,746	L237F	probably damaging	Het
Ccdc178	T	G	18: 22,019,041	K672T	possibly damaging	Het
Ccdc63	T	G	5: 122,110,946	K440T	possibly damaging	Het
Cd55b	A	T	1: 130,414,076	W275R	probably damaging	Het
Col4a3	T	C	1: 82,708,576		probably benign	Het
Dmpk	C	G	7: 19,087,270	D204E	probably damaging	Het
Egfr	T	C	11: 16,862,964	V148A	probably damaging	Het
F11	A	T	8: 45,241,494	V610E	probably damaging	Het
Fam83b	A	T	9: 76,491,295	I842N	probably damaging	Het
Fbxw9	T	C	8: 85,062,029	Y165H	probably benign	Het
Fzd6	C	T	15: 39,025,678	L64F	probably damaging	Het
Galntl6	A	T	8: 58,911,340	H45Q	probably benign	Het
Gbp7	C	A	3: 142,541,557	S276*	probably null	Het
Gnb5	A	T	9: 75,335,651	I168F	probably damaging	Het
Gon4l	T	C	3: 88,898,096		probably benign	Het
Gpat4	C	T	8: 23,180,911	C95Y	probably damaging	Het
Gstm7	T	A	3: 107,926,986		probably benign	Het
Hyal4	A	G	6: 24,755,746		probably benign	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kank4	G	A	4: 98,756,519	R999W	probably benign	Het
Kdm2a	A	G	19: 4,329,191	V92A	probably benign	Het
Klhl9	T	C	4: 88,721,737	D89G	probably benign	Het
Klre1	A	G	6: 129,582,415	T103A	probably benign	Het
Lamc1	CGCTGGC	CGC	1: 153,221,646		probably null	Het
Lamc1	G	T	1: 153,221,700	L1533I	probably benign	Het
Lca5l	T	C	16: 96,161,360	H455R	possibly damaging	Het
Lmo7	C	A	14: 101,794,269	T33K	probably benign	Het
Lrig1	A	G	6: 94,663,914		probably benign	Het
Mep1b	T	A	18: 21,088,729	Y245*	probably null	Het
Mettl24	A	G	10: 40,810,619	T331A	possibly damaging	Het
Mycbp2	A	C	14: 103,184,835	D2467E	probably damaging	Het
Myo15b	T	C	11: 115,882,454	S1871P	probably benign	Het
Ncbp1	T	C	4: 46,165,193	L502P	possibly damaging	Het
Npr1	T	C	3: 90,458,721	N588D	possibly damaging	Het
Olfr1008	A	T	2: 85,689,446	T6S	probably benign	Het
Olfr130	T	A	17: 38,067,923	Y251N	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Phactr4	A	G	4: 132,378,420	S112P	probably benign	Het
R3hdm1	C	T	1: 128,193,596	T279I	probably benign	Het
Rere	A	G	4: 150,615,372		probably benign	Het
Ryr1	T	A	7: 29,009,697	E4779V	unknown	Het
Sh2d4b	A	G	14: 40,874,182	V81A	probably benign	Het
Slc10a5	T	C	3: 10,334,424	H392R	probably benign	Het
Slc26a4	T	C	12: 31,535,619	T477A	probably benign	Het
Spata31d1b	T	C	13: 59,717,804	V922A	possibly damaging	Het
Sptan1	T	A	2: 29,980,063		probably null	Het
Stard9	A	G	2: 120,693,439	D705G	probably benign	Het
Tdpoz3	T	A	3: 93,826,881	S288T	probably benign	Het
Tsga10	A	G	1: 37,761,428		probably null	Het
Usp18	G	A	6: 121,261,493	A200T	probably benign	Het
Zfp759	A	T	13: 67,139,863	T493S	probably benign	Het

Other mutations in Aox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Aox2	APN	1	58322801	missense	possibly damaging	0.73
IGL01288:Aox2	APN	1	58294407	missense	probably damaging	0.99
IGL01383:Aox2	APN	1	58294305	missense	probably benign	0.09
IGL01734:Aox2	APN	1	58354310	missense	possibly damaging	0.95
IGL01793:Aox2	APN	1	58336624	missense	possibly damaging	0.79
IGL01834:Aox2	APN	1	58309024	missense	possibly damaging	0.90
IGL01924:Aox2	APN	1	58287743	missense	possibly damaging	0.90
IGL02591:Aox2	APN	1	58358999	nonsense	probably null
IGL02645:Aox2	APN	1	58334724	missense	probably damaging	1.00
IGL02710:Aox2	APN	1	58334769	critical splice donor site	probably null
IGL02801:Aox2	APN	1	58354177	missense	probably damaging	1.00
IGL02988:Aox2	APN	1	58337350	missense	probably benign
IGL03104:Aox2	APN	1	58282759	missense	probably benign
IGL03121:Aox2	APN	1	58358954	missense	probably damaging	1.00
IGL03191:Aox2	APN	1	58359069	missense	probably null	0.98
IGL03236:Aox2	APN	1	58309997	nonsense	probably null
IGL03409:Aox2	APN	1	58354429	missense	possibly damaging	0.91
PIT4362001:Aox2	UTSW	1	58282680	missense	probably damaging	1.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0035:Aox2	UTSW	1	58354422	missense	probably benign	0.00
R0267:Aox2	UTSW	1	58339446	splice site	probably benign
R0388:Aox2	UTSW	1	58354406	missense	probably damaging	1.00
R0409:Aox2	UTSW	1	58336624	missense	possibly damaging	0.90
R0547:Aox2	UTSW	1	58310042	missense	probably damaging	0.96
R0630:Aox2	UTSW	1	58337321	splice site	probably benign
R0726:Aox2	UTSW	1	58334782	splice site	probably benign
R0734:Aox2	UTSW	1	58305341	missense	probably benign	0.22
R0831:Aox2	UTSW	1	58339683	missense	probably benign	0.28
R1404:Aox2	UTSW	1	58346212	splice site	probably benign
R1512:Aox2	UTSW	1	58307351	missense	probably benign	0.00
R1573:Aox2	UTSW	1	58309027	missense	probably benign	0.00
R1592:Aox2	UTSW	1	58300694	missense	probably benign	0.00
R1747:Aox2	UTSW	1	58339592	missense	probably benign	0.01
R1768:Aox2	UTSW	1	58354195	missense	probably benign	0.00
R1809:Aox2	UTSW	1	58294325	missense	probably benign
R1823:Aox2	UTSW	1	58312359	missense	probably benign	0.02
R1834:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1835:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R1836:Aox2	UTSW	1	58308991	missense	probably benign	0.08
R2219:Aox2	UTSW	1	58349130	splice site	probably null
R2220:Aox2	UTSW	1	58349130	splice site	probably null
R2508:Aox2	UTSW	1	58343673	missense	probably benign	0.38
R2942:Aox2	UTSW	1	58337381	missense	probably benign	0.03
R2967:Aox2	UTSW	1	58322834	missense	probably damaging	0.96
R3082:Aox2	UTSW	1	58283600	splice site	probably benign
R3161:Aox2	UTSW	1	58304438	missense	possibly damaging	0.91
R3408:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R3803:Aox2	UTSW	1	58289899	splice site	probably null
R3894:Aox2	UTSW	1	58334678	critical splice acceptor site	probably null
R4214:Aox2	UTSW	1	58307444	critical splice donor site	probably null
R4249:Aox2	UTSW	1	58299819	missense	probably benign	0.01
R4666:Aox2	UTSW	1	58304597	nonsense	probably null
R4668:Aox2	UTSW	1	58334694	missense	possibly damaging	0.63
R4703:Aox2	UTSW	1	58358957	missense	possibly damaging	0.78
R4758:Aox2	UTSW	1	58332582	missense	probably benign	0.00
R4890:Aox2	UTSW	1	58334703	missense	probably benign	0.11
R4900:Aox2	UTSW	1	58305385	missense	probably benign
R4924:Aox2	UTSW	1	58305344	missense	probably damaging	1.00
R4970:Aox2	UTSW	1	58310095	splice site	probably null
R5112:Aox2	UTSW	1	58310095	splice site	probably null
R5987:Aox2	UTSW	1	58307359	missense	probably benign	0.00
R6239:Aox2	UTSW	1	58305391	critical splice donor site	probably null
R6273:Aox2	UTSW	1	58339672	missense	probably benign	0.00
R6291:Aox2	UTSW	1	58330806	missense	probably damaging	0.98
R6334:Aox2	UTSW	1	58307407	nonsense	probably null
R6764:Aox2	UTSW	1	58350282	missense	probably damaging	0.97
R6766:Aox2	UTSW	1	58349068	missense	possibly damaging	0.95
R6789:Aox2	UTSW	1	58304485	missense	probably benign	0.01
R6804:Aox2	UTSW	1	58304598	missense	probably benign	0.04
R7007:Aox2	UTSW	1	58330892	missense	probably damaging	1.00
R7015:Aox2	UTSW	1	58282758	missense	probably benign	0.00
R7055:Aox2	UTSW	1	58299768	missense	probably benign	0.08
R7089:Aox2	UTSW	1	58336649	missense	probably benign	0.01
R7157:Aox2	UTSW	1	58283492	missense	probably benign	0.00
R7303:Aox2	UTSW	1	58334765	nonsense	probably null
R7426:Aox2	UTSW	1	58289983	nonsense	probably null
R7762:Aox2	UTSW	1	58349104	missense	probably damaging	1.00
R7899:Aox2	UTSW	1	58281237	splice site	probably null
R7942:Aox2	UTSW	1	58337431	missense	probably damaging	1.00
R7975:Aox2	UTSW	1	58309028	missense	probably benign	0.02
R8029:Aox2	UTSW	1	58343668	missense	probably benign	0.32
R8032:Aox2	UTSW	1	58350283	missense	probably benign	0.01
R8147:Aox2	UTSW	1	58300662	missense	probably benign	0.02
R8165:Aox2	UTSW	1	58308929	missense	probably benign	0.08
R8326:Aox2	UTSW	1	58295887	missense	probably benign
R8770:Aox2	UTSW	1	58339604	missense	probably benign	0.10
R8973:Aox2	UTSW	1	58289954	missense	probably benign	0.34
R9015:Aox2	UTSW	1	58343692	missense	probably damaging	1.00
R9097:Aox2	UTSW	1	58287728	missense	possibly damaging	0.82
R9101:Aox2	UTSW	1	58332637	missense	probably benign	0.03
R9108:Aox2	UTSW	1	58282692	missense	probably damaging	1.00
R9180:Aox2	UTSW	1	58339618	nonsense	probably null
R9258:Aox2	UTSW	1	58312356	missense	probably damaging	1.00
R9293:Aox2	UTSW	1	58322794	missense	possibly damaging	0.86
R9519:Aox2	UTSW	1	58334767	missense	probably damaging	0.98
R9581:Aox2	UTSW	1	58330896	critical splice donor site	probably null
Z1177:Aox2	UTSW	1	58354397	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- ACACTACTCTATGGCAGGTTTACCCTC -3'
(R):5'- AGGTAGAATGGTGGCACTTGGGA -3'

Sequencing Primer
(F):5'- GCAGGTTTACCCTCATTGCTAAAG -3'
(R):5'- CACTTGGGAAAGAGGAGCC -3'

Posted On

2013-11-08