Incidental Mutation 'R0961:Atg9a'
ID81852
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Nameautophagy related 9A
SynonymsApg9l1
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location75180860-75192196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75186746 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 237 (L237F)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: L229F
Meta Mutation Damage Score 0.1729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75190366 missense probably damaging 1.00
IGL02041:Atg9a APN 1 75183104 missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75187957 missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75187953 nonsense probably null
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0408:Atg9a UTSW 1 75185295 missense probably damaging 1.00
R0520:Atg9a UTSW 1 75186534 nonsense probably null
R0653:Atg9a UTSW 1 75190328 missense probably damaging 0.96
R0666:Atg9a UTSW 1 75185090 missense probably damaging 0.99
R1489:Atg9a UTSW 1 75186090 missense probably damaging 1.00
R1490:Atg9a UTSW 1 75185745 missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75190355 missense probably benign 0.04
R1997:Atg9a UTSW 1 75189626 missense probably benign 0.33
R2005:Atg9a UTSW 1 75185991 missense probably benign 0.18
R2172:Atg9a UTSW 1 75185685 missense probably damaging 0.99
R4004:Atg9a UTSW 1 75186451 missense probably damaging 1.00
R4105:Atg9a UTSW 1 75185959 missense probably damaging 1.00
R5010:Atg9a UTSW 1 75186060 unclassified probably null
R5220:Atg9a UTSW 1 75185728 missense probably damaging 1.00
R5898:Atg9a UTSW 1 75186272 missense probably damaging 1.00
R6295:Atg9a UTSW 1 75185058 missense probably benign 0.01
R6390:Atg9a UTSW 1 75187981 missense probably damaging 1.00
R7312:Atg9a UTSW 1 75188092 missense probably damaging 1.00
R7729:Atg9a UTSW 1 75184560 missense probably benign 0.34
R8111:Atg9a UTSW 1 75187722 missense probably damaging 1.00
RF021:Atg9a UTSW 1 75182629 missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75186559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGCATAGCTGAAGAAGGCATAG -3'
(R):5'- TGCACATGGCAGGAAGTTCAGG -3'

Sequencing Primer
(F):5'- TTGGCGATGCCAATCCAC -3'
(R):5'- AAGTTCAGGCCCGGATTG -3'
Posted On2013-11-08