Incidental Mutation 'R0961:Atg9a'
ID 81852
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 039090-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0961 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 75163390 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 237 (L237F)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: L237F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: L237F

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: L229F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Meta Mutation Damage Score 0.1729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,314,686 (GRCm39) S331A probably benign Het
4930433I11Rik A T 7: 40,642,480 (GRCm39) T141S probably benign Het
4933412E24Rik T C 15: 59,887,160 (GRCm39) I427V probably benign Het
Abca15 A T 7: 119,960,208 (GRCm39) K664* probably null Het
Adcy8 A G 15: 64,626,711 (GRCm39) V709A possibly damaging Het
Aox1 T A 1: 58,349,230 (GRCm39) D665E probably benign Het
Arhgap22 C T 14: 33,089,070 (GRCm39) T352M probably damaging Het
Ccdc178 T G 18: 22,152,098 (GRCm39) K672T possibly damaging Het
Ccdc63 T G 5: 122,249,009 (GRCm39) K440T possibly damaging Het
Cd55b A T 1: 130,341,813 (GRCm39) W275R probably damaging Het
Col4a3 T C 1: 82,686,297 (GRCm39) probably benign Het
Dmpk C G 7: 18,821,195 (GRCm39) D204E probably damaging Het
Egfr T C 11: 16,812,964 (GRCm39) V148A probably damaging Het
F11 A T 8: 45,694,531 (GRCm39) V610E probably damaging Het
Fam83b A T 9: 76,398,577 (GRCm39) I842N probably damaging Het
Fbxw9 T C 8: 85,788,658 (GRCm39) Y165H probably benign Het
Fzd6 C T 15: 38,889,073 (GRCm39) L64F probably damaging Het
Galntl6 A T 8: 59,364,374 (GRCm39) H45Q probably benign Het
Gbp7 C A 3: 142,247,318 (GRCm39) S276* probably null Het
Gnb5 A T 9: 75,242,933 (GRCm39) I168F probably damaging Het
Gon4l T C 3: 88,805,403 (GRCm39) probably benign Het
Gpat4 C T 8: 23,670,927 (GRCm39) C95Y probably damaging Het
Gstm7 T A 3: 107,834,302 (GRCm39) probably benign Het
Hyal4 A G 6: 24,755,745 (GRCm39) probably benign Het
Iqca1 C A 1: 90,070,453 (GRCm39) G133V probably null Het
Kank4 G A 4: 98,644,756 (GRCm39) R999W probably benign Het
Kdm2a A G 19: 4,379,219 (GRCm39) V92A probably benign Het
Klhl9 T C 4: 88,639,974 (GRCm39) D89G probably benign Het
Klre1 A G 6: 129,559,378 (GRCm39) T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,097,392 (GRCm39) probably null Het
Lamc1 G T 1: 153,097,446 (GRCm39) L1533I probably benign Het
Lca5l T C 16: 95,962,560 (GRCm39) H455R possibly damaging Het
Lmo7 C A 14: 102,031,705 (GRCm39) T33K probably benign Het
Lrig1 A G 6: 94,640,895 (GRCm39) probably benign Het
Mep1b T A 18: 21,221,786 (GRCm39) Y245* probably null Het
Mettl24 A G 10: 40,686,615 (GRCm39) T331A possibly damaging Het
Mycbp2 A C 14: 103,422,271 (GRCm39) D2467E probably damaging Het
Myo15b T C 11: 115,773,280 (GRCm39) S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 (GRCm39) L502P possibly damaging Het
Npr1 T C 3: 90,366,028 (GRCm39) N588D possibly damaging Het
Or2g7 T A 17: 38,378,814 (GRCm39) Y251N probably damaging Het
Or8k16 A T 2: 85,519,790 (GRCm39) T6S probably benign Het
Oxtr C T 6: 112,454,138 (GRCm39) R42Q probably benign Het
Phactr4 A G 4: 132,105,731 (GRCm39) S112P probably benign Het
R3hdm1 C T 1: 128,121,333 (GRCm39) T279I probably benign Het
Rere A G 4: 150,699,829 (GRCm39) probably benign Het
Ryr1 T A 7: 28,709,122 (GRCm39) E4779V unknown Het
Sh2d4b A G 14: 40,596,139 (GRCm39) V81A probably benign Het
Slc10a5 T C 3: 10,399,484 (GRCm39) H392R probably benign Het
Slc26a4 T C 12: 31,585,618 (GRCm39) T477A probably benign Het
Spata31d1b T C 13: 59,865,618 (GRCm39) V922A possibly damaging Het
Sptan1 T A 2: 29,870,075 (GRCm39) probably null Het
Stard9 A G 2: 120,523,920 (GRCm39) D705G probably benign Het
Tdpoz3 T A 3: 93,734,188 (GRCm39) S288T probably benign Het
Tsga10 A G 1: 37,800,509 (GRCm39) probably null Het
Usp18 G A 6: 121,238,452 (GRCm39) A200T probably benign Het
Zfp759 A T 13: 67,287,927 (GRCm39) T493S probably benign Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGCATAGCTGAAGAAGGCATAG -3'
(R):5'- TGCACATGGCAGGAAGTTCAGG -3'

Sequencing Primer
(F):5'- TTGGCGATGCCAATCCAC -3'
(R):5'- AAGTTCAGGCCCGGATTG -3'
Posted On 2013-11-08