Incidental Mutation 'R0961:Slc10a5'
ID81863
Institutional Source Beutler Lab
Gene Symbol Slc10a5
Ensembl Gene ENSMUSG00000058921
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 5
SynonymsLOC241877
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location10331734-10335656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10334424 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 392 (H392R)
Ref Sequence ENSEMBL: ENSMUSP00000077808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000065938
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078748
AA Change: H392R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921
AA Change: H392R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118410
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128912
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191670
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Slc10a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Slc10a5 APN 3 10335309 missense probably benign 0.05
IGL01785:Slc10a5 APN 3 10335199 missense probably benign 0.00
IGL01823:Slc10a5 APN 3 10334514 missense possibly damaging 0.93
IGL01915:Slc10a5 APN 3 10335520 missense probably damaging 0.98
IGL02522:Slc10a5 APN 3 10335121 missense probably benign 0.09
IGL02721:Slc10a5 APN 3 10334535 missense probably benign 0.01
PIT4382001:Slc10a5 UTSW 3 10335447 missense probably benign
R0558:Slc10a5 UTSW 3 10335117 missense probably damaging 1.00
R1747:Slc10a5 UTSW 3 10335391 missense probably benign 0.04
R1889:Slc10a5 UTSW 3 10335490 missense probably benign 0.33
R2130:Slc10a5 UTSW 3 10335218 missense probably benign
R2171:Slc10a5 UTSW 3 10335282 missense possibly damaging 0.59
R2970:Slc10a5 UTSW 3 10335067 missense probably damaging 1.00
R2972:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R2973:Slc10a5 UTSW 3 10334457 missense probably damaging 0.98
R4241:Slc10a5 UTSW 3 10335460 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335299 missense probably damaging 1.00
R4700:Slc10a5 UTSW 3 10335300 missense probably damaging 1.00
R4790:Slc10a5 UTSW 3 10335036 missense probably damaging 1.00
R4834:Slc10a5 UTSW 3 10334799 missense probably damaging 0.97
R4891:Slc10a5 UTSW 3 10334625 missense possibly damaging 0.79
R5220:Slc10a5 UTSW 3 10335088 nonsense probably null
R5548:Slc10a5 UTSW 3 10334317 missense probably benign
R5748:Slc10a5 UTSW 3 10335331 missense probably benign 0.00
R6573:Slc10a5 UTSW 3 10335050 missense probably damaging 1.00
R6909:Slc10a5 UTSW 3 10335595 missense possibly damaging 0.90
R7355:Slc10a5 UTSW 3 10334315 nonsense probably null
R7807:Slc10a5 UTSW 3 10335469 missense probably benign 0.00
R7866:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
R7949:Slc10a5 UTSW 3 10334472 missense probably damaging 0.99
Z1176:Slc10a5 UTSW 3 10334487 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCACACCATCAGGTCTTTTG -3'
(R):5'- GCGGCCTCTGAGCTTGACTTTAATG -3'

Sequencing Primer
(F):5'- catgttatacgcacctgtatgtc -3'
(R):5'- CTAGTGTTTCTGAGAATGGCTAACC -3'
Posted On2013-11-08