Incidental Mutation 'R0961:Gbp7'
ID81868
Institutional Source Beutler Lab
Gene Symbol Gbp7
Ensembl Gene ENSMUSG00000040253
Gene Nameguanylate binding protein 7
Synonyms9830147J24Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142530342-142550149 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 142541557 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 276 (S276*)
Ref Sequence ENSEMBL: ENSMUSP00000132970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045097] [ENSMUST00000171263]
Predicted Effect probably null
Transcript: ENSMUST00000045097
AA Change: S276*
SMART Domains Protein: ENSMUSP00000049104
Gene: ENSMUSG00000040253
AA Change: S276*

DomainStartEndE-ValueType
Pfam:GBP 18 281 6.6e-128 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171263
AA Change: S276*
SMART Domains Protein: ENSMUSP00000132970
Gene: ENSMUSG00000040253
AA Change: S276*

DomainStartEndE-ValueType
Pfam:GBP 18 281 1e-126 PFAM
Pfam:GBP_C 283 579 2.8e-127 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylate-binding proteins, such as GBP7, are induced by interferon and hydrolyze GTP to both GDP and GMP (Olszewski et al., 2006 [PubMed 16689661]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Gbp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00731:Gbp7 APN 3 142546428 missense probably benign 0.01
IGL01020:Gbp7 APN 3 142542857 missense probably benign 0.03
IGL01959:Gbp7 APN 3 142541347 splice site probably benign
IGL02002:Gbp7 APN 3 142538900 missense probably damaging 1.00
IGL02008:Gbp7 APN 3 142546450 missense probably benign 0.11
PIT4366001:Gbp7 UTSW 3 142542951 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0103:Gbp7 UTSW 3 142546538 missense probably benign
R0398:Gbp7 UTSW 3 142545513 missense possibly damaging 0.93
R0486:Gbp7 UTSW 3 142546317 splice site probably benign
R0645:Gbp7 UTSW 3 142538165 intron probably null
R1834:Gbp7 UTSW 3 142534680 missense probably damaging 1.00
R2089:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2089:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2091:Gbp7 UTSW 3 142545555 splice site probably benign
R2091:Gbp7 UTSW 3 142534622 missense probably damaging 0.97
R2181:Gbp7 UTSW 3 142544030 missense possibly damaging 0.87
R2921:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R2922:Gbp7 UTSW 3 142534572 missense probably benign 0.00
R3819:Gbp7 UTSW 3 142544065 missense possibly damaging 0.81
R4747:Gbp7 UTSW 3 142543017 missense probably damaging 1.00
R4748:Gbp7 UTSW 3 142538087 missense probably benign 0.00
R5899:Gbp7 UTSW 3 142546542 missense probably benign
R6082:Gbp7 UTSW 3 142545936 missense probably benign 0.01
R6211:Gbp7 UTSW 3 142545993 missense probably benign 0.12
R6330:Gbp7 UTSW 3 142546498 missense probably benign
R6419:Gbp7 UTSW 3 142546453 missense probably benign 0.00
R7120:Gbp7 UTSW 3 142543973 missense probably damaging 1.00
R7338:Gbp7 UTSW 3 142538025 missense probably damaging 1.00
R7844:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7910:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
R7927:Gbp7 UTSW 3 142536386 missense probably benign 0.10
R7991:Gbp7 UTSW 3 142534641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGCCTGAAGACTGTCCTTTCCAAC -3'
(R):5'- TCTAGCCAGACAAAGAAACATGAGTGC -3'

Sequencing Primer
(F):5'- TTTGCAGGCATGAGTATCAAAGC -3'
(R):5'- ATTACTTCAAACACAGGTATTCCCTC -3'
Posted On2013-11-08