Incidental Mutation 'R0961:Phactr4'
ID81872
Institutional Source Beutler Lab
Gene Symbol Phactr4
Ensembl Gene ENSMUSG00000066043
Gene Namephosphatase and actin regulator 4
Synonyms3110001B12Rik, C330013F19Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location132355923-132422489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132378420 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 112 (S112P)
Ref Sequence ENSEMBL: ENSMUSP00000119767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084170] [ENSMUST00000084249] [ENSMUST00000102568] [ENSMUST00000136711] [ENSMUST00000152271]
Predicted Effect probably benign
Transcript: ENSMUST00000084170
AA Change: S112P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081185
Gene: ENSMUSG00000066043
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 471 481 N/A INTRINSIC
low complexity region 488 497 N/A INTRINSIC
Blast:RPEL 511 535 8e-7 BLAST
RPEL 548 573 2.53e-8 SMART
RPEL 586 611 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084249
AA Change: S149P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081270
Gene: ENSMUSG00000066043
AA Change: S149P

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
RPEL 73 98 1.35e-3 SMART
low complexity region 125 140 N/A INTRINSIC
low complexity region 172 186 N/A INTRINSIC
low complexity region 194 219 N/A INTRINSIC
low complexity region 231 270 N/A INTRINSIC
low complexity region 291 301 N/A INTRINSIC
low complexity region 335 359 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 525 534 N/A INTRINSIC
Blast:RPEL 548 572 9e-7 BLAST
RPEL 585 610 2.53e-8 SMART
RPEL 623 648 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102568
AA Change: S139P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099628
Gene: ENSMUSG00000066043
AA Change: S139P

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
RPEL 63 88 1.35e-3 SMART
low complexity region 115 130 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
low complexity region 184 209 N/A INTRINSIC
low complexity region 221 260 N/A INTRINSIC
low complexity region 281 291 N/A INTRINSIC
low complexity region 325 349 N/A INTRINSIC
low complexity region 498 508 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
Blast:RPEL 538 562 9e-7 BLAST
RPEL 575 600 2.53e-8 SMART
RPEL 613 638 2.17e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136711
AA Change: S122P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122194
Gene: ENSMUSG00000066043
AA Change: S122P

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152271
AA Change: S112P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119767
Gene: ENSMUSG00000066043
AA Change: S112P

DomainStartEndE-ValueType
low complexity region 42 59 N/A INTRINSIC
low complexity region 88 103 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
low complexity region 194 233 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator (PHACTR) family. Other PHACTR family members have been shown to inhibit protein phosphatase 1 (PP1) activity, and the homolog of this gene in the mouse has been shown to interact with actin and PP1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality, exencephaly, neural tube defects, coloboma, and altered cell cycles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Phactr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Phactr4 APN 4 132370992 missense possibly damaging 0.94
IGL01106:Phactr4 APN 4 132370805 missense probably benign 0.09
IGL01962:Phactr4 APN 4 132363775 missense probably damaging 0.99
IGL02382:Phactr4 APN 4 132370841 missense probably damaging 1.00
IGL02466:Phactr4 APN 4 132377172 splice site probably benign
IGL02891:Phactr4 APN 4 132387023 missense probably damaging 1.00
P0027:Phactr4 UTSW 4 132371090 missense probably damaging 1.00
R0317:Phactr4 UTSW 4 132386930 missense probably damaging 1.00
R1435:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1441:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1443:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1960:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R1961:Phactr4 UTSW 4 132377248 missense probably benign 0.06
R2145:Phactr4 UTSW 4 132370784 missense probably damaging 0.98
R3077:Phactr4 UTSW 4 132397996 start codon destroyed probably null 0.53
R3423:Phactr4 UTSW 4 132369747 missense probably benign 0.38
R3782:Phactr4 UTSW 4 132367867 unclassified probably null
R3871:Phactr4 UTSW 4 132377249 missense probably benign 0.00
R4427:Phactr4 UTSW 4 132387041 missense possibly damaging 0.90
R4672:Phactr4 UTSW 4 132370706 missense probably damaging 1.00
R4871:Phactr4 UTSW 4 132378448 missense probably damaging 1.00
R5264:Phactr4 UTSW 4 132370982 missense probably damaging 0.99
R5558:Phactr4 UTSW 4 132378455 missense probably damaging 1.00
R5955:Phactr4 UTSW 4 132386909 missense probably damaging 1.00
R6953:Phactr4 UTSW 4 132377351 missense possibly damaging 0.66
R7210:Phactr4 UTSW 4 132358271 makesense probably null
R7286:Phactr4 UTSW 4 132377178 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGGTGGTGCCTAACCCAAAA -3'
(R):5'- CCTCTCAGATGGTGAGGATTCAGGA -3'

Sequencing Primer
(F):5'- GGTGCCTAACCCaaaataaaataaac -3'
(R):5'- AAAGCTGAGCCATGCTGC -3'
Posted On2013-11-08