Incidental Mutation 'R0961:Lrig1'
ID81875
Institutional Source Beutler Lab
Gene Symbol Lrig1
Ensembl Gene ENSMUSG00000030029
Gene Nameleucine-rich repeats and immunoglobulin-like domains 1
SynonymsLIG-1, Img
MMRRC Submission 039090-MU
Accession Numbers

Genbank: NM_008377; MGI: 107935

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0961 (G1)
Quality Score211
Status Validated
Chromosome6
Chromosomal Location94604529-94700158 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 94663914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032105] [ENSMUST00000101126] [ENSMUST00000204645]
Predicted Effect probably benign
Transcript: ENSMUST00000032105
SMART Domains Protein: ENSMUSP00000032105
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101126
SMART Domains Protein: ENSMUSP00000098686
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141014
Predicted Effect probably benign
Transcript: ENSMUST00000204645
SMART Domains Protein: ENSMUSP00000144963
Gene: ENSMUSG00000030029

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
LRRNT 42 74 5.82e-6 SMART
LRR 68 92 4.83e0 SMART
LRR 93 115 9.96e-1 SMART
LRR 142 163 6.22e0 SMART
LRR 166 187 1.81e1 SMART
LRR 190 212 5.72e0 SMART
LRR 213 235 1.06e1 SMART
LRR_TYP 236 259 2.79e-4 SMART
LRR 260 283 2.54e1 SMART
LRR 284 307 9.96e-1 SMART
LRR 308 331 4.21e1 SMART
LRR_TYP 332 355 8.6e-5 SMART
LRR 356 382 1.06e1 SMART
LRR 383 406 9.96e-1 SMART
LRR_TYP 407 430 3.34e-2 SMART
LRRCT 442 492 3.5e-15 SMART
IGc2 509 586 1.34e-4 SMART
IGc2 613 681 2.87e-13 SMART
IGc2 707 772 6.44e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype Strain: 2675424
PHENOTYPE: Homozygous null mice developed psoriasiform epidermal hyperplasia. Homozygotes exhibit hair follicle, epidermis, vertebral, eye and hearing abnormalities, decreased body size and fat amount, and increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(4) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Lrig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Lrig1 APN 6 94611404 missense probably damaging 0.99
IGL01356:Lrig1 APN 6 94654920 missense probably benign 0.00
IGL01356:Lrig1 APN 6 94609893 missense probably damaging 1.00
IGL02001:Lrig1 APN 6 94607324 missense probably benign 0.00
IGL02019:Lrig1 APN 6 94616429 missense probably damaging 0.98
IGL02177:Lrig1 APN 6 94663996 missense possibly damaging 0.76
IGL02274:Lrig1 APN 6 94663938 missense possibly damaging 0.90
IGL03197:Lrig1 APN 6 94606118 missense probably benign
IGL03263:Lrig1 APN 6 94611647 missense probably benign 0.00
IGL03327:Lrig1 APN 6 94606123 missense probably benign 0.10
N/A - 293:Lrig1 UTSW 6 94609087 missense probably benign
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R0019:Lrig1 UTSW 6 94607349 nonsense probably null
R1018:Lrig1 UTSW 6 94622602 splice site probably benign
R1381:Lrig1 UTSW 6 94606130 missense probably benign 0.04
R1473:Lrig1 UTSW 6 94607313 missense probably benign 0.16
R1498:Lrig1 UTSW 6 94627987 missense possibly damaging 0.89
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R1888:Lrig1 UTSW 6 94654878 missense probably benign 0.03
R2273:Lrig1 UTSW 6 94608143 missense probably damaging 1.00
R2513:Lrig1 UTSW 6 94617366 intron probably null
R3001:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3002:Lrig1 UTSW 6 94608777 missense probably damaging 1.00
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3732:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3733:Lrig1 UTSW 6 94611576 missense possibly damaging 0.86
R3772:Lrig1 UTSW 6 94605817 missense probably benign 0.00
R4089:Lrig1 UTSW 6 94609859 missense possibly damaging 0.83
R4093:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4095:Lrig1 UTSW 6 94613578 missense probably benign 0.10
R4225:Lrig1 UTSW 6 94622658 missense probably damaging 1.00
R4917:Lrig1 UTSW 6 94609719 missense probably damaging 1.00
R4951:Lrig1 UTSW 6 94663978 missense probably damaging 1.00
R4976:Lrig1 UTSW 6 94625062 missense probably damaging 1.00
R5000:Lrig1 UTSW 6 94611449 missense probably damaging 1.00
R5149:Lrig1 UTSW 6 94628044 missense possibly damaging 0.93
R5732:Lrig1 UTSW 6 94699539 nonsense probably null
R5988:Lrig1 UTSW 6 94628042 missense probably damaging 0.99
R6064:Lrig1 UTSW 6 94626447 missense probably damaging 1.00
R6292:Lrig1 UTSW 6 94616445 missense probably damaging 1.00
R6723:Lrig1 UTSW 6 94626405 missense probably damaging 1.00
R6815:Lrig1 UTSW 6 94625029 missense probably damaging 1.00
R6889:Lrig1 UTSW 6 94625063 missense probably benign 0.07
R6995:Lrig1 UTSW 6 94611629 missense possibly damaging 0.95
R7404:Lrig1 UTSW 6 94626471 missense probably damaging 1.00
R7487:Lrig1 UTSW 6 94606118 missense probably benign
R7732:Lrig1 UTSW 6 94626377 missense probably benign 0.05
Z1176:Lrig1 UTSW 6 94609026 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTATGAGGGCTCCACTCCTCAAC -3'
(R):5'- AGAGCGATGTTTATGAAGCTCACCG -3'

Sequencing Primer
(F):5'- tccatacaaaagtcaaccatagaaag -3'
(R):5'- ATGAAGCTCACCGTGTCTG -3'
Posted On2013-11-08