Incidental Mutation 'R0961:Usp18'
ID81877
Institutional Source Beutler Lab
Gene Symbol Usp18
Ensembl Gene ENSMUSG00000030107
Gene Nameubiquitin specific peptidase 18
Synonyms1110058H21Rik, UBP43
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121245906-121270917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121261493 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 200 (A200T)
Ref Sequence ENSEMBL: ENSMUSP00000032198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032198]
Predicted Effect probably benign
Transcript: ENSMUST00000032198
AA Change: A200T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032198
Gene: ENSMUSG00000030107
AA Change: A200T

DomainStartEndE-ValueType
Pfam:UCH 51 363 3.1e-41 PFAM
Pfam:UCH_1 52 335 6.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204926
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mutants die prematurely with cellular necrosis in the ependyma, breakdown of blood-brain barrier, hydrocephaly with enlarged ventricles, and severe neurological abnormalities. Mice homozygous for an ENU-induced allele exhibit increased susceptibility to Salmonella infection and LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Usp18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Usp18 APN 6 121255382 nonsense probably null
IGL01403:Usp18 APN 6 121268668 missense possibly damaging 0.67
IGL01411:Usp18 APN 6 121261421 missense probably benign 0.01
IGL01810:Usp18 APN 6 121253771 missense probably damaging 1.00
IGL02568:Usp18 APN 6 121261091 missense probably benign 0.00
IGL02613:Usp18 APN 6 121261090 missense probably benign 0.11
R1350:Usp18 UTSW 6 121262692 missense possibly damaging 0.64
R1855:Usp18 UTSW 6 121262117 missense probably benign 0.07
R1916:Usp18 UTSW 6 121268554 missense probably benign 0.14
R1981:Usp18 UTSW 6 121252517 missense probably benign 0.08
R2015:Usp18 UTSW 6 121268550 missense probably damaging 1.00
R4062:Usp18 UTSW 6 121261367 missense probably benign
R5000:Usp18 UTSW 6 121252520 missense possibly damaging 0.84
R5894:Usp18 UTSW 6 121261497 missense probably benign 0.03
R6006:Usp18 UTSW 6 121262822 missense possibly damaging 0.58
R6932:Usp18 UTSW 6 121252514 missense probably benign 0.01
R7357:Usp18 UTSW 6 121253849 missense possibly damaging 0.90
Z1177:Usp18 UTSW 6 121255275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTAAGGACCAGATCACGGACAC -3'
(R):5'- TGTACACATGCCAAGGCATAGACAG -3'

Sequencing Primer
(F):5'- aacaaataaacaaacaaacaaacCAC -3'
(R):5'- caaggcatagacagggagaac -3'
Posted On2013-11-08