Incidental Mutation 'R0961:Dmpk'
ID81879
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 039090-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 19087270 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 204 (D204E)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000032570] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000108479] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032568
AA Change: D204E

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: D204E

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032570
SMART Domains Protein: ENSMUSP00000032570
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 653 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108473
AA Change: D204E

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: D204E

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108474
AA Change: D204E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: D204E

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108479
SMART Domains Protein: ENSMUSP00000104119
Gene: ENSMUSG00000030410

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 44 92 N/A INTRINSIC
WD40 203 239 4.11e1 SMART
WD40 270 309 3.5e-4 SMART
WD40 312 351 2.01e-4 SMART
WD40 354 436 8.36e-2 SMART
low complexity region 450 471 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
Blast:WD40 509 620 1e-43 BLAST
low complexity region 628 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect possibly damaging
Transcript: ENSMUST00000154199
AA Change: D204E

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: D204E

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.6433 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAGATCCCATTGGGGACAGAATCG -3'
(R):5'- TGGGAGCACAAGCCACTAAGTCAG -3'

Sequencing Primer
(F):5'- ATCGGGGTCTAGAATTGTAGAATC -3'
(R):5'- TGTGCCAATCAGACCTGAATG -3'
Posted On2013-11-08