Incidental Mutation 'R0961:Fbxw9'
ID81886
Institutional Source Beutler Lab
Gene Symbol Fbxw9
Ensembl Gene ENSMUSG00000008167
Gene NameF-box and WD-40 domain protein 9
SynonymsFbw9, 1110017H11Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0961 (G1)
Quality Score211
Status Validated
Chromosome8
Chromosomal Location85060055-85067124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85062029 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 165 (Y165H)
Ref Sequence ENSEMBL: ENSMUSP00000092845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000095220] [ENSMUST00000166592]
Predicted Effect probably benign
Transcript: ENSMUST00000093360
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095220
AA Change: Y165H

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000092845
Gene: ENSMUSG00000008167
AA Change: Y165H

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
FBOX 82 123 7.47e-4 SMART
WD40 161 201 2.98e-1 SMART
WD40 210 252 4.55e-3 SMART
WD40 256 292 7.8e-2 SMART
WD40 296 333 1.03e0 SMART
WD40 377 415 2.57e0 SMART
Blast:WD40 419 455 8e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably benign
Transcript: ENSMUST00000166592
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXW9, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603034), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Fbxw9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Fbxw9 APN 8 85066590 missense probably damaging 0.99
IGL01108:Fbxw9 APN 8 85065977 unclassified probably benign
IGL01633:Fbxw9 APN 8 85064426 missense probably damaging 1.00
IGL02672:Fbxw9 APN 8 85066053 splice site probably null
R0053:Fbxw9 UTSW 8 85064454 missense probably damaging 1.00
R0053:Fbxw9 UTSW 8 85064454 missense probably damaging 1.00
R0535:Fbxw9 UTSW 8 85064600 missense probably damaging 1.00
R1171:Fbxw9 UTSW 8 85066078 missense possibly damaging 0.95
R2371:Fbxw9 UTSW 8 85062029 missense probably benign 0.05
R4472:Fbxw9 UTSW 8 85060200 missense probably damaging 1.00
R4864:Fbxw9 UTSW 8 85065901 missense probably damaging 1.00
R4865:Fbxw9 UTSW 8 85060156 missense possibly damaging 0.62
R5236:Fbxw9 UTSW 8 85066345 missense probably damaging 0.98
R5771:Fbxw9 UTSW 8 85064572 splice site probably null
R6670:Fbxw9 UTSW 8 85062210 missense possibly damaging 0.55
R6861:Fbxw9 UTSW 8 85066111 missense probably damaging 0.99
R7354:Fbxw9 UTSW 8 85062196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGTAGCCTGAGACAAAGCCAG -3'
(R):5'- GCAACTGTTGTGTGCCAAAGACC -3'

Sequencing Primer
(F):5'- AAAGCCAGAGCCTGTGC -3'
(R):5'- AGGTCCCACAGGTTGACATTC -3'
Posted On2013-11-08