Incidental Mutation 'R0961:Spata31d1b'
ID81894
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Namespermatogenesis associated 31 subfamily D, member 1B
SynonymsFam75d1b, Gm4934
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59712284-59719295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59717804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 922 (V922A)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165133
AA Change: V922A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: V922A

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1662:Spata31d1b UTSW 13 59716628 missense probably benign 0.00
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R1995:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6433:Spata31d1b UTSW 13 59717185 missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7147:Spata31d1b UTSW 13 59718214 missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
R7457:Spata31d1b UTSW 13 59716909 missense probably damaging 0.99
R7469:Spata31d1b UTSW 13 59715464 missense probably benign 0.04
R7519:Spata31d1b UTSW 13 59716912 missense probably benign 0.43
R7548:Spata31d1b UTSW 13 59716654 missense probably benign
R7586:Spata31d1b UTSW 13 59718380 missense probably damaging 1.00
R7657:Spata31d1b UTSW 13 59715763 missense possibly damaging 0.46
R7778:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R7824:Spata31d1b UTSW 13 59717233 missense possibly damaging 0.65
R8078:Spata31d1b UTSW 13 59715449 missense probably damaging 0.99
Z1177:Spata31d1b UTSW 13 59712409 missense probably damaging 1.00
Z1177:Spata31d1b UTSW 13 59715451 missense probably benign 0.44
Z1177:Spata31d1b UTSW 13 59718860 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAGCAGAGCCTTCTCAGCCTTTCC -3'
(R):5'- TCTTAGTGGACTGTGGGTGAAGACC -3'

Sequencing Primer
(F):5'- TCAGCTCCACGTTCAAGC -3'
(R):5'- CGGGAGTTGCTCTCCCTTG -3'
Posted On2013-11-08