Incidental Mutation 'R0961:Arhgap22'
ID81896
Institutional Source Beutler Lab
Gene Symbol Arhgap22
Ensembl Gene ENSMUSG00000063506
Gene NameRho GTPase activating protein 22
SynonymsRHOGAP2, B230341L19Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0961 (G1)
Quality Score183
Status Validated
Chromosome14
Chromosomal Location33214026-33369934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33367113 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 352 (T352M)
Ref Sequence ENSEMBL: ENSMUSP00000107586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111955] [ENSMUST00000111956] [ENSMUST00000140711]
Predicted Effect probably damaging
Transcript: ENSMUST00000111955
AA Change: T352M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107586
Gene: ENSMUSG00000063506
AA Change: T352M

DomainStartEndE-ValueType
Blast:PH 18 57 6e-18 BLAST
RhoGAP 80 187 3.03e-7 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 340 381 N/A INTRINSIC
low complexity region 388 398 N/A INTRINSIC
coiled coil region 447 526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111956
AA Change: T517M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000107587
Gene: ENSMUSG00000063506
AA Change: T517M

DomainStartEndE-ValueType
PH 44 153 1.03e-24 SMART
RhoGAP 176 352 1.96e-65 SMART
low complexity region 472 483 N/A INTRINSIC
low complexity region 505 546 N/A INTRINSIC
low complexity region 553 563 N/A INTRINSIC
coiled coil region 612 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140166
Predicted Effect probably benign
Transcript: ENSMUST00000140711
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTPase activating protein family which activates a GTPase belonging to the RAS superfamily of small GTP-binding proteins. The encoded protein is insulin-responsive, is dependent on the kinase Akt and requires the Akt-dependent 14-3-3 binding protein which binds sequentially to two serine residues. The result of these interactions is regulation of cell motility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Arhgap22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Arhgap22 APN 14 33359273 missense probably damaging 1.00
IGL02707:Arhgap22 APN 14 33363272 splice site probably benign
R0329:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0330:Arhgap22 UTSW 14 33369417 missense possibly damaging 0.55
R0335:Arhgap22 UTSW 14 33359108 splice site probably benign
R0625:Arhgap22 UTSW 14 33366714 missense probably benign 0.01
R1167:Arhgap22 UTSW 14 33343307 unclassified probably null
R1991:Arhgap22 UTSW 14 33366959 missense probably damaging 0.98
R3820:Arhgap22 UTSW 14 33367421 missense probably benign 0.41
R4377:Arhgap22 UTSW 14 33369510 missense probably damaging 0.99
R4670:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R4671:Arhgap22 UTSW 14 33362543 missense probably damaging 1.00
R5177:Arhgap22 UTSW 14 33366693 missense probably benign 0.09
R5910:Arhgap22 UTSW 14 33366615 missense probably damaging 0.98
R7297:Arhgap22 UTSW 14 33271933 nonsense probably null
R7868:Arhgap22 UTSW 14 33364516 unclassified probably benign
R7951:Arhgap22 UTSW 14 33364516 unclassified probably benign
R8128:Arhgap22 UTSW 14 33367085 missense probably benign 0.00
Z1176:Arhgap22 UTSW 14 33362522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAAACGGGCTATCGTCTCTTCGC -3'
(R):5'- AGTCCTCTGCTGACACAACTCTGC -3'

Sequencing Primer
(F):5'- ATCGTCTCTTCGCAGCCAC -3'
(R):5'- ATGGCTCATCCAGGCTGTG -3'
Posted On2013-11-08