Incidental Mutation 'R0961:Fzd6'
Institutional Source Beutler Lab
Gene Symbol Fzd6
Ensembl Gene ENSMUSG00000022297
Gene Namefrizzled class receptor 6
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0961 (G1)
Quality Score121
Status Validated
Chromosomal Location39006034-39038188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39025678 bp
Amino Acid Change Leucine to Phenylalanine at position 64 (L64F)
Ref Sequence ENSEMBL: ENSMUSP00000136328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022906] [ENSMUST00000179165]
Predicted Effect probably damaging
Transcript: ENSMUST00000022906
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022906
Gene: ENSMUSG00000022297
AA Change: L64F

signal peptide 1 18 N/A INTRINSIC
FRI 23 134 9.66e-59 SMART
Frizzled 188 513 4.88e-184 SMART
low complexity region 532 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179165
AA Change: L64F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136328
Gene: ENSMUSG00000022297
AA Change: L64F

signal peptide 1 18 N/A INTRINSIC
FRI 23 134 9.66e-59 SMART
Frizzled 188 513 4.88e-184 SMART
low complexity region 532 543 N/A INTRINSIC
Meta Mutation Damage Score 0.8510 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the 'frizzled' gene family, which encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The protein encoded by this family member contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, and seven transmembrane domains, but unlike other family members, this protein does not contain a C-terminal PDZ domain-binding motif. This protein functions as a negative regulator of the canonical Wnt/beta-catenin signaling cascade, thereby inhibiting the processes that trigger oncogenic transformation, cell proliferation, and inhibition of apoptosis. Alternative splicing results in multiple transcript variants, some of which do not encode a protein with a predicted signal peptide.[provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mice for one mutation display abnormal hair follicle orientation. Another mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Kdm2a A G 19: 4,329,191 V92A probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Fzd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02470:Fzd6 APN 15 39036557 utr 3 prime probably benign
IGL02500:Fzd6 APN 15 39031386 missense probably damaging 1.00
IGL02938:Fzd6 APN 15 39033890 missense probably benign 0.03
IGL03219:Fzd6 APN 15 39031576 missense probably damaging 1.00
R0314:Fzd6 UTSW 15 39025733 missense possibly damaging 0.88
R0458:Fzd6 UTSW 15 39031281 missense probably damaging 1.00
R0478:Fzd6 UTSW 15 39034034 intron probably null
R1473:Fzd6 UTSW 15 39030963 missense probably damaging 1.00
R1479:Fzd6 UTSW 15 39030999 missense probably damaging 1.00
R1533:Fzd6 UTSW 15 39031624 missense probably damaging 1.00
R1731:Fzd6 UTSW 15 39031327 missense probably damaging 1.00
R1836:Fzd6 UTSW 15 39033920 missense probably damaging 1.00
R2241:Fzd6 UTSW 15 39031536 missense probably damaging 0.96
R5089:Fzd6 UTSW 15 39007480 missense probably damaging 1.00
R5526:Fzd6 UTSW 15 39031164 missense possibly damaging 0.89
R5666:Fzd6 UTSW 15 39031115 missense probably benign 0.32
R5670:Fzd6 UTSW 15 39031115 missense probably benign 0.32
R5903:Fzd6 UTSW 15 39007388 start codon destroyed probably null 0.99
R6221:Fzd6 UTSW 15 39030844 missense probably benign 0.00
R6944:Fzd6 UTSW 15 39025817 missense possibly damaging 0.69
R7731:Fzd6 UTSW 15 39033932 missense probably damaging 1.00
Z1177:Fzd6 UTSW 15 39007561 missense possibly damaging 0.72
Z1177:Fzd6 UTSW 15 39031341 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttaaattaaaggaagaaggacctctg -3'
Posted On2013-11-08