Incidental Mutation 'R0961:Kdm2a'
ID81907
Institutional Source Beutler Lab
Gene Symbol Kdm2a
Ensembl Gene ENSMUSG00000054611
Gene Namelysine (K)-specific demethylase 2A
SynonymsGm4560, lalina, Fbl7, Jhdm1a, Cxxc8, Fbxl11, 5530401A10Rik
MMRRC Submission 039090-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0961 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4314419-4398285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4329191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000135745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047898] [ENSMUST00000075856] [ENSMUST00000176497] [ENSMUST00000176653]
Predicted Effect probably benign
Transcript: ENSMUST00000047898
AA Change: V532A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047683
Gene: ENSMUSG00000054611
AA Change: V532A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075856
AA Change: V532A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000076698
Gene: ENSMUSG00000054611
AA Change: V532A

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
JmjC 148 316 1.52e-34 SMART
low complexity region 416 433 N/A INTRINSIC
PDB:2YU2|A 440 517 1e-35 PDB
Pfam:zf-CXXC 563 609 7.5e-16 PFAM
PHD 619 676 3.25e-4 SMART
low complexity region 848 875 N/A INTRINSIC
FBOX 892 932 1.58e-2 SMART
low complexity region 987 998 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176497
SMART Domains Protein: ENSMUSP00000135471
Gene: ENSMUSG00000054611

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176653
AA Change: V92A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135745
Gene: ENSMUSG00000054611
AA Change: V92A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
PDB:2YU2|A 52 77 4e-7 PDB
Pfam:zf-CXXC 123 169 3e-16 PFAM
PHD 179 236 3.25e-4 SMART
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class and, in addition to an F-box, contains at least six highly degenerated leucine-rich repeats. This family member plays a role in epigenetic silencing. It nucleates at CpG islands and specifically demethylates both mono- and di-methylated lysine-36 of histone H3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele show embryonic lethality, severe growth retardation, reduced neuron proliferation, increased neuron apoptosis, impaired neuron differentiation, small hearts, abnormal cardiac looping and, in some cases, incomplete embryonic turning and neural tube closure defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A C 2: 151,472,766 S331A probably benign Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4933412E24Rik T C 15: 60,015,311 I427V probably benign Het
Abca15 A T 7: 120,360,985 K664* probably null Het
Adcy8 A G 15: 64,754,862 V709A possibly damaging Het
Aox2 T A 1: 58,310,071 D665E probably benign Het
Arhgap22 C T 14: 33,367,113 T352M probably damaging Het
Atg9a G A 1: 75,186,746 L237F probably damaging Het
Ccdc178 T G 18: 22,019,041 K672T possibly damaging Het
Ccdc63 T G 5: 122,110,946 K440T possibly damaging Het
Cd55b A T 1: 130,414,076 W275R probably damaging Het
Col4a3 T C 1: 82,708,576 probably benign Het
Dmpk C G 7: 19,087,270 D204E probably damaging Het
Egfr T C 11: 16,862,964 V148A probably damaging Het
F11 A T 8: 45,241,494 V610E probably damaging Het
Fam83b A T 9: 76,491,295 I842N probably damaging Het
Fbxw9 T C 8: 85,062,029 Y165H probably benign Het
Fzd6 C T 15: 39,025,678 L64F probably damaging Het
Galntl6 A T 8: 58,911,340 H45Q probably benign Het
Gbp7 C A 3: 142,541,557 S276* probably null Het
Gnb5 A T 9: 75,335,651 I168F probably damaging Het
Gon4l T C 3: 88,898,096 probably benign Het
Gpat4 C T 8: 23,180,911 C95Y probably damaging Het
Gstm7 T A 3: 107,926,986 probably benign Het
Hyal4 A G 6: 24,755,746 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kank4 G A 4: 98,756,519 R999W probably benign Het
Klhl9 T C 4: 88,721,737 D89G probably benign Het
Klre1 A G 6: 129,582,415 T103A probably benign Het
Lamc1 CGCTGGC CGC 1: 153,221,646 probably null Het
Lamc1 G T 1: 153,221,700 L1533I probably benign Het
Lca5l T C 16: 96,161,360 H455R possibly damaging Het
Lmo7 C A 14: 101,794,269 T33K probably benign Het
Lrig1 A G 6: 94,663,914 probably benign Het
Mep1b T A 18: 21,088,729 Y245* probably null Het
Mettl24 A G 10: 40,810,619 T331A possibly damaging Het
Mycbp2 A C 14: 103,184,835 D2467E probably damaging Het
Myo15b T C 11: 115,882,454 S1871P probably benign Het
Ncbp1 T C 4: 46,165,193 L502P possibly damaging Het
Npr1 T C 3: 90,458,721 N588D possibly damaging Het
Olfr1008 A T 2: 85,689,446 T6S probably benign Het
Olfr130 T A 17: 38,067,923 Y251N probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Phactr4 A G 4: 132,378,420 S112P probably benign Het
R3hdm1 C T 1: 128,193,596 T279I probably benign Het
Rere A G 4: 150,615,372 probably benign Het
Ryr1 T A 7: 29,009,697 E4779V unknown Het
Sh2d4b A G 14: 40,874,182 V81A probably benign Het
Slc10a5 T C 3: 10,334,424 H392R probably benign Het
Slc26a4 T C 12: 31,535,619 T477A probably benign Het
Spata31d1b T C 13: 59,717,804 V922A possibly damaging Het
Sptan1 T A 2: 29,980,063 probably null Het
Stard9 A G 2: 120,693,439 D705G probably benign Het
Tdpoz3 T A 3: 93,826,881 S288T probably benign Het
Tsga10 A G 1: 37,761,428 probably null Het
Usp18 G A 6: 121,261,493 A200T probably benign Het
Zfp759 A T 13: 67,139,863 T493S probably benign Het
Other mutations in Kdm2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Kdm2a APN 19 4356898 missense possibly damaging 0.94
IGL00679:Kdm2a APN 19 4326841 missense probably damaging 1.00
IGL01104:Kdm2a APN 19 4356738 splice site probably benign
IGL01161:Kdm2a APN 19 4319251 missense probably benign 0.04
IGL01433:Kdm2a APN 19 4342860 missense possibly damaging 0.83
IGL01456:Kdm2a APN 19 4351755 missense probably damaging 1.00
IGL01467:Kdm2a APN 19 4324407 missense probably damaging 0.99
IGL01517:Kdm2a APN 19 4362061 splice site probably benign
IGL01528:Kdm2a APN 19 4343055 missense probably benign 0.18
IGL02504:Kdm2a APN 19 4356771 missense possibly damaging 0.92
IGL02895:Kdm2a APN 19 4362902 missense probably damaging 1.00
IGL03109:Kdm2a APN 19 4329107 missense probably benign 0.04
IGL03171:Kdm2a APN 19 4356764 missense probably damaging 1.00
IGL03256:Kdm2a APN 19 4345510 unclassified probably benign
P0027:Kdm2a UTSW 19 4343245 splice site probably benign
PIT4382001:Kdm2a UTSW 19 4343173 missense probably benign
R0220:Kdm2a UTSW 19 4324919 missense possibly damaging 0.85
R1662:Kdm2a UTSW 19 4328212 missense probably damaging 1.00
R2023:Kdm2a UTSW 19 4322464 missense probably damaging 0.98
R2191:Kdm2a UTSW 19 4356931 splice site probably null
R2207:Kdm2a UTSW 19 4362870 missense probably damaging 1.00
R2351:Kdm2a UTSW 19 4329126 missense probably benign 0.02
R2406:Kdm2a UTSW 19 4322518 missense probably damaging 1.00
R2882:Kdm2a UTSW 19 4331184 critical splice donor site probably null
R3788:Kdm2a UTSW 19 4351805 missense probably damaging 0.99
R3792:Kdm2a UTSW 19 4324512 missense possibly damaging 0.91
R3950:Kdm2a UTSW 19 4343232 missense possibly damaging 0.89
R4235:Kdm2a UTSW 19 4322521 missense probably damaging 0.98
R4377:Kdm2a UTSW 19 4329054 missense probably benign 0.01
R4466:Kdm2a UTSW 19 4320300 missense probably damaging 0.99
R4766:Kdm2a UTSW 19 4324507 unclassified probably benign
R4824:Kdm2a UTSW 19 4362787 missense probably damaging 1.00
R4838:Kdm2a UTSW 19 4325026 missense probably benign 0.41
R5283:Kdm2a UTSW 19 4331269 missense probably benign 0.00
R6366:Kdm2a UTSW 19 4324932 missense probably benign 0.15
R6368:Kdm2a UTSW 19 4350317 missense probably damaging 1.00
R6522:Kdm2a UTSW 19 4324826 missense possibly damaging 0.49
R6716:Kdm2a UTSW 19 4329102 missense probably damaging 1.00
R6757:Kdm2a UTSW 19 4319243 missense probably damaging 0.98
R6912:Kdm2a UTSW 19 4322501 missense probably benign 0.06
R6996:Kdm2a UTSW 19 4345641 missense probably benign 0.16
R7090:Kdm2a UTSW 19 4319141 missense probably damaging 1.00
R7497:Kdm2a UTSW 19 4324376 missense probably damaging 1.00
R7542:Kdm2a UTSW 19 4333830 start gained probably benign
RF046:Kdm2a UTSW 19 4324507 unclassified probably benign
X0028:Kdm2a UTSW 19 4320271 missense possibly damaging 0.77
X0028:Kdm2a UTSW 19 4348746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCACCAATACCAAGCCTTGC -3'
(R):5'- GGCCAGTTTTGCCTACAGACATCTC -3'

Sequencing Primer
(F):5'- GACACAGGATTGCTTCATGC -3'
(R):5'- ACAGACATCTCTTTGCCAGTC -3'
Posted On2013-11-08