Incidental Mutation 'R0879:Pde6d'
ID81909
Institutional Source Beutler Lab
Gene Symbol Pde6d
Ensembl Gene ENSMUSG00000026239
Gene Namephosphodiesterase 6D, cGMP-specific, rod, delta
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location86542994-86582629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86545801 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 91 (F91S)
Ref Sequence ENSEMBL: ENSMUSP00000137820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027444] [ENSMUST00000143674] [ENSMUST00000146220]
Predicted Effect probably benign
Transcript: ENSMUST00000027444
AA Change: F91S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027444
Gene: ENSMUSG00000026239
AA Change: F91S

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 9 149 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143674
SMART Domains Protein: ENSMUSP00000137956
Gene: ENSMUSG00000026239

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 64 4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146220
AA Change: F91S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137820
Gene: ENSMUSG00000026239
AA Change: F91S

DomainStartEndE-ValueType
Pfam:GMP_PDE_delta 7 124 6.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150653
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the delta subunit of rod-specific photoreceptor phosphodiesterase (PDE), a key enzyme in the phototransduction cascade. A similar protein in cow functions in solubilizing membrane-bound PDE. In addition to its role in the PDE complex, the encoded protein is thought to bind to prenyl groups of proteins to target them to subcellular organelles called cilia. Mutations in this gene are associated with Joubert syndrome-22. Alternative splicing results in multiple splice variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice exhibit progressive retinal degeneration with progressive loss of rod and cone neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Pde6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
costume UTSW 1 86547526 splice site probably null
R1446:Pde6d UTSW 1 86546692 missense probably damaging 0.99
R2018:Pde6d UTSW 1 86546716 missense probably damaging 1.00
R2118:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2119:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2120:Pde6d UTSW 1 86545802 missense probably benign 0.10
R2122:Pde6d UTSW 1 86545802 missense probably benign 0.10
R3084:Pde6d UTSW 1 86547526 splice site probably null
R3085:Pde6d UTSW 1 86547526 splice site probably null
R6824:Pde6d UTSW 1 86545763 missense possibly damaging 0.49
R7775:Pde6d UTSW 1 86543528 missense probably damaging 1.00
R7778:Pde6d UTSW 1 86543528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCCTGAATGCCTGTTCTAAG -3'
(R):5'- GCTTGCTGCTCCTAAGAAAATGCTG -3'

Sequencing Primer
(F):5'- TCAAGGACTGCCAGGTGTTT -3'
(R):5'- caggaagtagaagcaggtgg -3'
Posted On2013-11-08