Incidental Mutation 'R0879:Zfp865'
ID81918
Institutional Source Beutler Lab
Gene Symbol Zfp865
Ensembl Gene ENSMUSG00000116184
Gene Name
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location5034118-5035246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5031343 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 776 (T776A)
Ref Sequence ENSEMBL: ENSMUSP00000075601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062428] [ENSMUST00000076251] [ENSMUST00000076791] [ENSMUST00000085427] [ENSMUST00000207050] [ENSMUST00000208728]
Predicted Effect probably benign
Transcript: ENSMUST00000062428
SMART Domains Protein: ENSMUSP00000051979
Gene: ENSMUSG00000043290

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
ZnF_C2H2 64 86 1.02e1 SMART
ZnF_C2H2 100 122 9.96e-1 SMART
ZnF_C2H2 128 150 6.67e-2 SMART
low complexity region 180 192 N/A INTRINSIC
ZnF_C2H2 195 217 4.11e-2 SMART
ZnF_C2H2 223 245 7.26e-3 SMART
ZnF_C2H2 251 273 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076251
AA Change: T776A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075601
Gene: ENSMUSG00000074405
AA Change: T776A

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
low complexity region 750 770 N/A INTRINSIC
low complexity region 772 788 N/A INTRINSIC
ZnF_C2H2 791 813 1.64e-1 SMART
ZnF_C2H2 819 841 9.3e-1 SMART
ZnF_C2H2 847 869 2.95e-3 SMART
ZnF_C2H2 875 897 3.83e-2 SMART
ZnF_C2H2 903 925 2.05e-2 SMART
ZnF_C2H2 931 953 1.18e-2 SMART
ZnF_C2H2 959 981 1.36e-2 SMART
ZnF_C2H2 988 1010 5.06e-2 SMART
ZnF_C2H2 1016 1038 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076791
Predicted Effect probably benign
Transcript: ENSMUST00000085427
SMART Domains Protein: ENSMUSP00000082550
Gene: ENSMUSG00000074405

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 62 82 N/A INTRINSIC
low complexity region 120 141 N/A INTRINSIC
low complexity region 171 193 N/A INTRINSIC
ZnF_C2H2 220 242 1.28e-3 SMART
ZnF_C2H2 248 270 5.5e-3 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 294 324 N/A INTRINSIC
ZnF_C2H2 350 372 8.81e-2 SMART
ZnF_C2H2 378 400 6.08e-5 SMART
ZnF_C2H2 407 429 1.79e-2 SMART
ZnF_C2H2 439 461 1.92e-2 SMART
low complexity region 478 495 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 523 542 N/A INTRINSIC
ZnF_C2H2 546 568 4.47e-3 SMART
ZnF_C2H2 574 596 5.42e-2 SMART
ZnF_C2H2 602 624 1.72e-4 SMART
low complexity region 628 660 N/A INTRINSIC
ZnF_C2H2 664 686 5.34e-1 SMART
ZnF_C2H2 692 714 2.82e0 SMART
low complexity region 725 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207362
Predicted Effect probably benign
Transcript: ENSMUST00000208728
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Zfp865
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Zfp865 APN 7 5029876 missense probably benign
IGL02041:Zfp865 APN 7 5031373 missense probably benign
IGL03118:Zfp865 APN 7 5034645 intron probably benign
R0613:Zfp865 UTSW 7 5029091 missense possibly damaging 0.86
R0938:Zfp865 UTSW 7 5031404 missense possibly damaging 0.96
R1448:Zfp865 UTSW 7 5029279 nonsense probably null
R3955:Zfp865 UTSW 7 5032014 missense probably damaging 0.96
R4841:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R4842:Zfp865 UTSW 7 5031641 missense probably damaging 1.00
R5044:Zfp865 UTSW 7 5034669 intron probably benign
R5773:Zfp865 UTSW 7 5034694 intron probably benign
R5843:Zfp865 UTSW 7 5030417 missense probably benign 0.03
R5849:Zfp865 UTSW 7 5031087 missense probably damaging 1.00
R6393:Zfp865 UTSW 7 5030066 missense probably damaging 1.00
R6480:Zfp865 UTSW 7 5029783 missense probably damaging 0.98
R6681:Zfp865 UTSW 7 5029451 missense possibly damaging 0.86
R6880:Zfp865 UTSW 7 5030549 missense probably damaging 1.00
R7252:Zfp865 UTSW 7 5034417 intron probably benign
R7302:Zfp865 UTSW 7 5029253 missense possibly damaging 0.96
R7486:Zfp865 UTSW 7 5031260 missense possibly damaging 0.85
R7611:Zfp865 UTSW 7 5031131 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGGCACAAGCTGGTTCACC -3'
(R):5'- AGCTCAGGTAGAAGAAGCCCTTGC -3'

Sequencing Primer
(F):5'- AAGCTGGTTCACCAGGCTG -3'
(R):5'- TCCGCTAGGCTAGAAGACTG -3'
Posted On2013-11-08