Incidental Mutation 'R0879:Vmn1r76'
ID81919
Institutional Source Beutler Lab
Gene Symbol Vmn1r76
Ensembl Gene ENSMUSG00000115267
Gene Namevomeronasal 1 receptor 76
SynonymsV1rg4
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location11923523-11938213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11930735 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 184 (I184N)
Ref Sequence ENSEMBL: ENSMUSP00000055518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058772] [ENSMUST00000226300] [ENSMUST00000226947]
Predicted Effect probably benign
Transcript: ENSMUST00000058772
AA Change: I184N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055518
Gene: ENSMUSG00000115267
AA Change: I184N

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
Pfam:V1R 54 317 5.4e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226300
AA Change: I149N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226947
AA Change: I149N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Vmn1r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Vmn1r76 APN 7 11930382 missense possibly damaging 0.50
IGL01353:Vmn1r76 APN 7 11930810 missense probably damaging 0.98
IGL02105:Vmn1r76 APN 7 11930490 missense possibly damaging 0.46
R0032:Vmn1r76 UTSW 7 11931267 missense probably benign
R1201:Vmn1r76 UTSW 7 11930325 missense probably benign 0.38
R1966:Vmn1r76 UTSW 7 11930514 missense probably damaging 1.00
R3030:Vmn1r76 UTSW 7 11930475 missense probably damaging 1.00
R3915:Vmn1r76 UTSW 7 11930569 missense probably benign 0.23
R4295:Vmn1r76 UTSW 7 11931130 missense probably benign 0.44
R5053:Vmn1r76 UTSW 7 11930314 splice site probably null
R5450:Vmn1r76 UTSW 7 11930684 missense probably damaging 1.00
R5568:Vmn1r76 UTSW 7 11931135 missense probably benign 0.02
R6382:Vmn1r76 UTSW 7 11930499 missense probably damaging 1.00
R7137:Vmn1r76 UTSW 7 11930685 missense possibly damaging 0.94
R7704:Vmn1r76 UTSW 7 11930417 missense probably benign 0.25
R8018:Vmn1r76 UTSW 7 11930883 missense probably damaging 0.99
Z1176:Vmn1r76 UTSW 7 11930568 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGCACTGTGGATATGCTTGACTCG -3'
(R):5'- AGCACTTGACTTTTGCCAATTGCC -3'

Sequencing Primer
(F):5'- ATGCTTGACTCGTTTCTTATGTCTG -3'
(R):5'- CCTGTGTATCATCTCAAAAGGC -3'
Posted On2013-11-08