Incidental Mutation 'R0879:Usp17le'
ID81922
Institutional Source Beutler Lab
Gene Symbol Usp17le
Ensembl Gene ENSMUSG00000043073
Gene Nameubiquitin specific peptidase 17-like E
SynonymsGm6596, Dub3
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104768049-104777470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104769647 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 96 (L96Q)
Ref Sequence ENSEMBL: ENSMUSP00000147776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053464] [ENSMUST00000211384]
Predicted Effect probably damaging
Transcript: ENSMUST00000053464
AA Change: L96Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051716
Gene: ENSMUSG00000043073
AA Change: L96Q

DomainStartEndE-ValueType
Pfam:UCH 84 379 9e-54 PFAM
Pfam:UCH_1 85 362 2.3e-21 PFAM
low complexity region 408 417 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211384
AA Change: L96Q

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Usp17le
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Usp17le APN 7 104768787 missense probably benign 0.00
IGL01974:Usp17le APN 7 104768435 missense probably benign
IGL02364:Usp17le APN 7 104768775 nonsense probably null
IGL02413:Usp17le APN 7 104769726 missense probably benign 0.39
IGL02433:Usp17le APN 7 104769201 missense probably benign 0.01
IGL02960:Usp17le APN 7 104768740 missense probably benign
IGL02984:Usp17le UTSW 7 104769104 missense probably benign 0.21
R0035:Usp17le UTSW 7 104769062 nonsense probably null
R0389:Usp17le UTSW 7 104768460 missense probably damaging 0.96
R0499:Usp17le UTSW 7 104768501 missense probably benign 0.02
R0567:Usp17le UTSW 7 104768898 missense possibly damaging 0.95
R0879:Usp17le UTSW 7 104769648 missense possibly damaging 0.46
R4840:Usp17le UTSW 7 104769770 missense probably benign 0.34
R5140:Usp17le UTSW 7 104769438 missense probably damaging 1.00
R5403:Usp17le UTSW 7 104769234 missense probably damaging 1.00
R6210:Usp17le UTSW 7 104769143 missense probably damaging 1.00
R7047:Usp17le UTSW 7 104768433 missense probably benign 0.02
R7157:Usp17le UTSW 7 104768489 missense probably benign 0.03
R7361:Usp17le UTSW 7 104768877 missense probably damaging 1.00
R7386:Usp17le UTSW 7 104768307 splice site probably null
R7997:Usp17le UTSW 7 104768839 missense possibly damaging 0.94
R8189:Usp17le UTSW 7 104769348 missense probably damaging 0.99
R8248:Usp17le UTSW 7 104769794 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACACTTGATCTGAGACCTCCACC -3'
(R):5'- ACTATCATCTCCTGATGCCCCAGAG -3'

Sequencing Primer
(F):5'- CACTTGAAGGCAGGATTCATGC -3'
(R):5'- GCTGCATCAGGATGAAGCTC -3'
Posted On2013-11-08