Incidental Mutation 'R0879:Zfp821'
ID81927
Institutional Source Beutler Lab
Gene Symbol Zfp821
Ensembl Gene ENSMUSG00000031728
Gene Namezinc finger protein 821
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109705546-109724932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109721842 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 135 (I135T)
Ref Sequence ENSEMBL: ENSMUSP00000148348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034163] [ENSMUST00000093162] [ENSMUST00000212000] [ENSMUST00000212192] [ENSMUST00000212605] [ENSMUST00000212964]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034163
AA Change: I135T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034163
Gene: ENSMUSG00000031728
AA Change: I135T

DomainStartEndE-ValueType
low complexity region 50 69 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 119 141 3.78e-1 SMART
ZnF_C2H2 151 173 7.26e-3 SMART
coiled coil region 260 334 N/A INTRINSIC
low complexity region 342 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093162
SMART Domains Protein: ENSMUSP00000090850
Gene: ENSMUSG00000069895

DomainStartEndE-ValueType
low complexity region 155 163 N/A INTRINSIC
low complexity region 182 197 N/A INTRINSIC
Pfam:AXH 467 580 3.1e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211918
Predicted Effect possibly damaging
Transcript: ENSMUST00000212000
AA Change: I135T

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212192
AA Change: I135T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212233
Predicted Effect probably benign
Transcript: ENSMUST00000212605
Predicted Effect probably benign
Transcript: ENSMUST00000212964
Meta Mutation Damage Score 0.7030 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two C2H2 zinc finger motifs and a score-and-three (23)-amino acid peptide repeat (STPR) domain. The STPR domain of the encoded protein binds to double stranded DNA and may also contain a nuclear localization signal, suggesting that this protein interacts with chromosomal DNA. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Zfp821
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Zfp821 APN 8 109709478 utr 5 prime probably benign
R0299:Zfp821 UTSW 8 109724230 missense probably damaging 1.00
R0685:Zfp821 UTSW 8 109724542 missense possibly damaging 0.87
R1743:Zfp821 UTSW 8 109724164 missense probably damaging 1.00
R1955:Zfp821 UTSW 8 109721242 missense probably damaging 1.00
R2117:Zfp821 UTSW 8 109721219 missense probably damaging 1.00
R2143:Zfp821 UTSW 8 109724347 missense probably damaging 1.00
R2145:Zfp821 UTSW 8 109724347 missense probably damaging 1.00
R2402:Zfp821 UTSW 8 109721240 missense probably damaging 1.00
R2421:Zfp821 UTSW 8 109709533 splice site probably null
R4906:Zfp821 UTSW 8 109724209 missense probably damaging 1.00
R4907:Zfp821 UTSW 8 109723993 missense probably benign 0.03
R5265:Zfp821 UTSW 8 109724359 missense probably damaging 1.00
R7691:Zfp821 UTSW 8 109721239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCAGGCTGTCTTGTGGAACC -3'
(R):5'- TTGGCCCTACCCCACTTTAAAAGC -3'

Sequencing Primer
(F):5'- GTATCCTAAGGATTCATGCCAGG -3'
(R):5'- AAAGCCGTCATTGTTAAGTCAG -3'
Posted On2013-11-08