Incidental Mutation 'R0879:Stra6'
ID81929
Institutional Source Beutler Lab
Gene Symbol Stra6
Ensembl Gene ENSMUSG00000032327
Gene Namestimulated by retinoic acid gene 6
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58063788-58153996 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 58135204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000085677] [ENSMUST00000128021] [ENSMUST00000128021] [ENSMUST00000128378] [ENSMUST00000128378] [ENSMUST00000133287] [ENSMUST00000133287] [ENSMUST00000134450] [ENSMUST00000134450] [ENSMUST00000134955] [ENSMUST00000134955] [ENSMUST00000136154] [ENSMUST00000136154] [ENSMUST00000136338] [ENSMUST00000136338] [ENSMUST00000147134] [ENSMUST00000147134] [ENSMUST00000150820] [ENSMUST00000150820] [ENSMUST00000167479] [ENSMUST00000167479] [ENSMUST00000170397] [ENSMUST00000170397]
Predicted Effect probably null
Transcript: ENSMUST00000034880
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085677
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128378
SMART Domains Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 164 4.7e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000128378
SMART Domains Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 164 4.7e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133287
SMART Domains Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 138 3.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133287
SMART Domains Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 138 3.4e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134450
Predicted Effect probably null
Transcript: ENSMUST00000134450
Predicted Effect probably null
Transcript: ENSMUST00000134955
SMART Domains Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 190 1.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134955
SMART Domains Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 190 1.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136338
SMART Domains Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 99 4e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136338
SMART Domains Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 99 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect probably null
Transcript: ENSMUST00000147134
SMART Domains Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 162 6.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147134
SMART Domains Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 162 6.2e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150820
SMART Domains Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 168 1.9e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150820
SMART Domains Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 168 1.9e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167479
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170397
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Stra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Stra6 APN 9 58152571 missense probably benign 0.01
IGL01885:Stra6 APN 9 58141148 missense probably damaging 1.00
IGL02219:Stra6 APN 9 58140469 missense probably benign 0.18
IGL02550:Stra6 APN 9 58150083 missense possibly damaging 0.95
IGL02745:Stra6 APN 9 58152038 missense probably damaging 1.00
IGL02999:Stra6 APN 9 58135113 missense probably benign 0.19
R0034:Stra6 UTSW 9 58151469 splice site probably null
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0281:Stra6 UTSW 9 58145489 missense probably benign 0.11
R0387:Stra6 UTSW 9 58153183 missense probably benign 0.13
R1075:Stra6 UTSW 9 58151404 missense possibly damaging 0.79
R1605:Stra6 UTSW 9 58151883 missense probably benign
R1840:Stra6 UTSW 9 58140530 missense probably benign 0.00
R1896:Stra6 UTSW 9 58151883 missense probably benign
R2149:Stra6 UTSW 9 58152539 missense probably benign 0.01
R4016:Stra6 UTSW 9 58135190 missense probably damaging 0.99
R4127:Stra6 UTSW 9 58151218 missense probably damaging 1.00
R4243:Stra6 UTSW 9 58143026 missense probably benign 0.06
R4631:Stra6 UTSW 9 58140832 intron probably benign
R4671:Stra6 UTSW 9 58149234 missense probably benign 0.01
R4688:Stra6 UTSW 9 58135076 critical splice acceptor site probably null
R5091:Stra6 UTSW 9 58141146 missense probably damaging 1.00
R6179:Stra6 UTSW 9 58135169 missense probably damaging 1.00
R6486:Stra6 UTSW 9 58151422 frame shift probably null
R6593:Stra6 UTSW 9 58151979 missense probably benign 0.00
R7368:Stra6 UTSW 9 58151260 missense probably benign 0.03
R7395:Stra6 UTSW 9 58141097 missense probably damaging 1.00
R7503:Stra6 UTSW 9 58151245 missense possibly damaging 0.70
R7807:Stra6 UTSW 9 58150161 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAAGAGAAGACTCCTGTCTGCCC -3'
(R):5'- TGACTCTCCCATGCCTGTAAAGCC -3'

Sequencing Primer
(F):5'- AAATGttcctttgtttcttcttcttc -3'
(R):5'- aagaactgttgtccccagg -3'
Posted On2013-11-08