Incidental Mutation 'R0879:Aagab'
ID81930
Institutional Source Beutler Lab
Gene Symbol Aagab
Ensembl Gene ENSMUSG00000037257
Gene Namealpha- and gamma-adaptin binding protein
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location63602660-63644588 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 63617610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041551] [ENSMUST00000213880]
Predicted Effect probably benign
Transcript: ENSMUST00000041551
SMART Domains Protein: ENSMUSP00000048595
Gene: ENSMUSG00000037257

DomainStartEndE-ValueType
Pfam:Adaptin_binding 155 295 3.8e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213880
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the gamma-adaptin and alpha-adaptin subunits of complexes involved in clathrin-coated vesicle trafficking. Mutations in this gene are associated with type I punctate palmoplantar keratoderma. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Aagab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Aagab APN 9 63639619 missense probably damaging 1.00
IGL01293:Aagab APN 9 63636469 missense probably benign
IGL01782:Aagab APN 9 63616713 missense probably benign 0.00
IGL02505:Aagab APN 9 63616814 missense probably damaging 0.99
IGL03085:Aagab APN 9 63639034 splice site probably benign
IGL03172:Aagab APN 9 63635394 intron probably benign
R0326:Aagab UTSW 9 63619162 missense probably damaging 0.96
R2141:Aagab UTSW 9 63616675 splice site probably null
R2142:Aagab UTSW 9 63616675 splice site probably null
R3954:Aagab UTSW 9 63619160 missense probably damaging 0.99
R3956:Aagab UTSW 9 63619160 missense probably damaging 0.99
R4886:Aagab UTSW 9 63636456 missense possibly damaging 0.69
R6193:Aagab UTSW 9 63617513 missense possibly damaging 0.94
R7899:Aagab UTSW 9 63616850 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTCTCTGATACTCCCACAGTGGC -3'
(R):5'- TCCATCGAACAAACTATGGCAGAGC -3'

Sequencing Primer
(F):5'- CAATGCCATTGACATTCGGGG -3'
(R):5'- caaaacaaacaaacaaacaaacaaac -3'
Posted On2013-11-08