Incidental Mutation 'R0879:Mybpc1'
ID81933
Institutional Source Beutler Lab
Gene Symbol Mybpc1
Ensembl Gene ENSMUSG00000020061
Gene Namemyosin binding protein C, slow-type
Synonyms8030451F13Rik, Slow-type C-protein
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88518279-88605152 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 88571516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]
Predicted Effect probably benign
Transcript: ENSMUST00000119185
SMART Domains Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
IG 51 147 1.96e-6 SMART
low complexity region 221 233 N/A INTRINSIC
IG 246 325 4.53e-2 SMART
IG 335 416 1.13e-2 SMART
IG 426 506 6.97e-3 SMART
IG 519 604 2.83e-3 SMART
FN3 607 690 4.28e-10 SMART
FN3 705 788 1.49e-9 SMART
low complexity region 800 812 N/A INTRINSIC
IG 815 898 9.06e-2 SMART
FN3 901 983 2.06e-12 SMART
IGc2 1028 1095 1.88e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121629
SMART Domains Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
IG 65 161 1.96e-6 SMART
low complexity region 235 247 N/A INTRINSIC
IG 260 339 4.53e-2 SMART
IG 349 430 1.13e-2 SMART
IG 440 520 6.97e-3 SMART
IG 533 618 2.83e-3 SMART
FN3 621 704 4.28e-10 SMART
FN3 719 802 1.49e-9 SMART
low complexity region 814 826 N/A INTRINSIC
IG 829 912 9.06e-2 SMART
FN3 915 997 2.06e-12 SMART
IGc2 1042 1109 1.88e-8 SMART
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Mybpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Mybpc1 APN 10 88549262 missense probably damaging 0.98
IGL00577:Mybpc1 APN 10 88536384 missense probably damaging 1.00
IGL00703:Mybpc1 APN 10 88525108 splice site probably null
IGL00964:Mybpc1 APN 10 88555742 critical splice acceptor site probably null
IGL01738:Mybpc1 APN 10 88570645 missense probably damaging 1.00
IGL01978:Mybpc1 APN 10 88531770 missense probably damaging 1.00
IGL02255:Mybpc1 APN 10 88536428 missense probably damaging 1.00
IGL02997:Mybpc1 APN 10 88526373 missense probably damaging 1.00
R0098:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0240:Mybpc1 UTSW 10 88555738 missense possibly damaging 0.59
R0449:Mybpc1 UTSW 10 88540960 missense probably damaging 1.00
R1321:Mybpc1 UTSW 10 88529541 missense possibly damaging 0.85
R1321:Mybpc1 UTSW 10 88570601 missense probably damaging 1.00
R1562:Mybpc1 UTSW 10 88553331 missense probably damaging 1.00
R1783:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R1803:Mybpc1 UTSW 10 88553295 missense possibly damaging 0.65
R1962:Mybpc1 UTSW 10 88548826 missense probably damaging 1.00
R1972:Mybpc1 UTSW 10 88551542 missense probably benign 0.00
R2006:Mybpc1 UTSW 10 88546059 missense probably damaging 0.99
R2125:Mybpc1 UTSW 10 88573437 nonsense probably null
R2129:Mybpc1 UTSW 10 88551452 missense probably damaging 1.00
R2163:Mybpc1 UTSW 10 88540942 splice site probably benign
R2200:Mybpc1 UTSW 10 88555695 missense probably damaging 1.00
R2219:Mybpc1 UTSW 10 88555678 missense probably damaging 1.00
R2270:Mybpc1 UTSW 10 88551407 missense probably benign 0.01
R2961:Mybpc1 UTSW 10 88531779 missense probably damaging 1.00
R3767:Mybpc1 UTSW 10 88570659 splice site probably null
R4032:Mybpc1 UTSW 10 88529564 missense probably benign 0.02
R4226:Mybpc1 UTSW 10 88573525 nonsense probably null
R4821:Mybpc1 UTSW 10 88548865 missense probably damaging 0.98
R4876:Mybpc1 UTSW 10 88522991 missense probably benign
R4876:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
R4878:Mybpc1 UTSW 10 88551430 missense possibly damaging 0.95
R4910:Mybpc1 UTSW 10 88555724 nonsense probably null
R4913:Mybpc1 UTSW 10 88553254 critical splice donor site probably null
R4964:Mybpc1 UTSW 10 88555663 missense probably benign 0.31
R5023:Mybpc1 UTSW 10 88543774 missense probably damaging 1.00
R5098:Mybpc1 UTSW 10 88546064 missense probably damaging 1.00
R5196:Mybpc1 UTSW 10 88536351 missense probably damaging 0.97
R5344:Mybpc1 UTSW 10 88570568 missense probably damaging 1.00
R5399:Mybpc1 UTSW 10 88523014 missense probably damaging 1.00
R5538:Mybpc1 UTSW 10 88546029 missense possibly damaging 0.89
R5808:Mybpc1 UTSW 10 88570566 missense possibly damaging 0.83
R5970:Mybpc1 UTSW 10 88542456 missense probably damaging 1.00
R6324:Mybpc1 UTSW 10 88568619 missense possibly damaging 0.56
R6433:Mybpc1 UTSW 10 88560355 missense probably damaging 1.00
R6441:Mybpc1 UTSW 10 88553277 missense probably benign 0.09
R6648:Mybpc1 UTSW 10 88522999 missense probably damaging 0.96
R6844:Mybpc1 UTSW 10 88536381 missense possibly damaging 0.50
R6931:Mybpc1 UTSW 10 88542330 nonsense probably null
R6972:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6973:Mybpc1 UTSW 10 88560361 missense possibly damaging 0.50
R6978:Mybpc1 UTSW 10 88523024 missense probably damaging 1.00
R7007:Mybpc1 UTSW 10 88553412 missense probably damaging 1.00
R7019:Mybpc1 UTSW 10 88543719 missense probably damaging 1.00
R7407:Mybpc1 UTSW 10 88549347 missense probably damaging 0.99
R7442:Mybpc1 UTSW 10 88526293 missense probably damaging 1.00
R7577:Mybpc1 UTSW 10 88549325 missense probably damaging 1.00
R7660:Mybpc1 UTSW 10 88548854 missense possibly damaging 0.51
R7768:Mybpc1 UTSW 10 88542372 missense probably damaging 1.00
R7818:Mybpc1 UTSW 10 88558667 missense probably damaging 1.00
R8171:Mybpc1 UTSW 10 88523003 missense probably damaging 1.00
R8195:Mybpc1 UTSW 10 88558691 missense possibly damaging 0.47
R8241:Mybpc1 UTSW 10 88536424 missense probably benign 0.03
Z1176:Mybpc1 UTSW 10 88560327 missense probably benign
Z1177:Mybpc1 UTSW 10 88573437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCTGTGGTTACCCAACCAGTAAAC -3'
(R):5'- ATTGTGAACACCTAAGCCCTGCTC -3'

Sequencing Primer
(F):5'- gctaacaccttgtcatcctcc -3'
(R):5'- CAGCAGTTTCTAAATCCCAGATG -3'
Posted On2013-11-08