Incidental Mutation 'R0879:Pelp1'
ID81936
Institutional Source Beutler Lab
Gene Symbol Pelp1
Ensembl Gene ENSMUSG00000018921
Gene Nameproline, glutamic acid and leucine rich protein 1
SynonymsMNAR, 4930563C04Rik
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70392883-70410031 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 70395297 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019065]
Predicted Effect probably benign
Transcript: ENSMUST00000019065
SMART Domains Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 232 7.5e-30 PFAM
low complexity region 264 278 N/A INTRINSIC
low complexity region 359 386 N/A INTRINSIC
Pfam:NUC202 424 490 8.6e-30 PFAM
Pfam:NUC202 570 644 6e-19 PFAM
low complexity region 748 758 N/A INTRINSIC
low complexity region 797 830 N/A INTRINSIC
low complexity region 834 863 N/A INTRINSIC
low complexity region 869 877 N/A INTRINSIC
SCOP:d1sig__ 892 958 9e-6 SMART
low complexity region 974 989 N/A INTRINSIC
low complexity region 993 1021 N/A INTRINSIC
low complexity region 1070 1090 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Pelp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Pelp1 APN 11 70394812 missense possibly damaging 0.88
IGL00819:Pelp1 APN 11 70394618 missense unknown
IGL01017:Pelp1 APN 11 70396894 missense probably damaging 1.00
IGL01347:Pelp1 APN 11 70395679 missense probably damaging 1.00
IGL01460:Pelp1 APN 11 70393964 missense unknown
IGL02022:Pelp1 APN 11 70406327 splice site probably benign
IGL02188:Pelp1 APN 11 70409892 missense unknown
ANU74:Pelp1 UTSW 11 70395087 missense probably damaging 0.97
F5770:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
R0056:Pelp1 UTSW 11 70393832 missense unknown
R0201:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0637:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R1073:Pelp1 UTSW 11 70396590 missense probably damaging 1.00
R1858:Pelp1 UTSW 11 70394742 missense probably damaging 0.99
R1937:Pelp1 UTSW 11 70393715 splice site probably null
R1958:Pelp1 UTSW 11 70398521 missense probably damaging 0.99
R3613:Pelp1 UTSW 11 70395435 missense probably benign 0.01
R3722:Pelp1 UTSW 11 70398200 missense possibly damaging 0.62
R4176:Pelp1 UTSW 11 70396867 missense probably damaging 1.00
R5137:Pelp1 UTSW 11 70395099 missense probably damaging 0.98
R5253:Pelp1 UTSW 11 70401661 missense probably damaging 1.00
R5616:Pelp1 UTSW 11 70394862 missense possibly damaging 0.73
R5911:Pelp1 UTSW 11 70396914 missense probably damaging 0.99
R5938:Pelp1 UTSW 11 70394867 missense probably damaging 0.98
R6461:Pelp1 UTSW 11 70396306 missense probably damaging 1.00
R7387:Pelp1 UTSW 11 70396599 missense probably damaging 0.99
R7625:Pelp1 UTSW 11 70395434 missense probably benign 0.03
R7694:Pelp1 UTSW 11 70394759 missense probably damaging 0.99
R7873:Pelp1 UTSW 11 70394726 missense probably damaging 1.00
V7580:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7581:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7582:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7583:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
Z1088:Pelp1 UTSW 11 70396890 missense probably damaging 1.00
Z1177:Pelp1 UTSW 11 70397094 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGATGCCTCCTCCTTATCGTAGTGG -3'
(R):5'- GGCAGCTCTCCTTACAACAGTTCC -3'

Sequencing Primer
(F):5'- TGGATGGCACAGCACCTATG -3'
(R):5'- ACAACAGTTCCTGCTGTCG -3'
Posted On2013-11-08