Incidental Mutation 'R0879:Gm4076'
ID81939
Institutional Source Beutler Lab
Gene Symbol Gm4076
Ensembl Gene ENSMUSG00000096449
Gene Namepredicted gene 4076
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location85126999-85127514 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 85127207 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179230
SMART Domains Protein: ENSMUSP00000137467
Gene: ENSMUSG00000096449

DomainStartEndE-ValueType
Pfam:Proton_antipo_M 1 171 2.9e-47 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Gm4076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03102:Gm4076 APN 13 85127319 exon noncoding transcript
R0499:Gm4076 UTSW 13 85127226 exon noncoding transcript
R1027:Gm4076 UTSW 13 85127389 exon noncoding transcript
R1117:Gm4076 UTSW 13 85127318 exon noncoding transcript
R1892:Gm4076 UTSW 13 85127328 exon noncoding transcript
R2880:Gm4076 UTSW 13 85127238 exon noncoding transcript
R3551:Gm4076 UTSW 13 85127150 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGCAAAGATGCTTCCGAATGCTAGG -3'
(R):5'- GCTATTTGTGCTCTCACCCAAAACG -3'

Sequencing Primer
(F):5'- CGATTAGTGTAATTAGTAGGGCTCAG -3'
(R):5'- GACATCAAAAAAATCGTCGCCTTC -3'
Posted On2013-11-08