Incidental Mutation 'R0879:Rft1'
ID81940
Institutional Source Beutler Lab
Gene Symbol Rft1
Ensembl Gene ENSMUSG00000052395
Gene NameRFT1 homolog
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30654360-30691317 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 30682748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064230] [ENSMUST00000226817] [ENSMUST00000228686]
Predicted Effect probably benign
Transcript: ENSMUST00000064230
SMART Domains Protein: ENSMUSP00000064153
Gene: ENSMUSG00000052395

DomainStartEndE-ValueType
Pfam:Rft-1 9 530 2.2e-140 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120407
Gene: ENSMUSG00000052395

DomainStartEndE-ValueType
Pfam:Rft-1 10 279 4.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226805
Predicted Effect probably benign
Transcript: ENSMUST00000226817
Predicted Effect probably benign
Transcript: ENSMUST00000228686
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the translocation of the Man(5)GlcNAc (2)-PP-Dol intermediate from the cytoplasmic to the luminal side of the endoplasmic reticulum membrane in the pathway for the N-glycosylation of proteins. Mutations in this gene are associated with congenital disorder of glycosylation type In.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Rft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Rft1 APN 14 30676896 missense possibly damaging 0.71
IGL01642:Rft1 APN 14 30676868 missense probably damaging 1.00
IGL01654:Rft1 APN 14 30676880 missense probably damaging 0.99
IGL01970:Rft1 APN 14 30690535 missense probably benign
IGL02403:Rft1 APN 14 30660321 splice site probably benign
IGL02928:Rft1 APN 14 30663115 missense possibly damaging 0.78
IGL03186:Rft1 APN 14 30658349 missense possibly damaging 0.90
IGL03286:Rft1 APN 14 30661366 missense probably benign 0.00
R0276:Rft1 UTSW 14 30690583 missense probably benign 0.28
R1491:Rft1 UTSW 14 30666787 nonsense probably null
R2423:Rft1 UTSW 14 30666767 missense possibly damaging 0.49
R3693:Rft1 UTSW 14 30690451 missense probably damaging 1.00
R4543:Rft1 UTSW 14 30661333 missense probably benign 0.24
R4611:Rft1 UTSW 14 30689790 missense probably damaging 0.98
R4878:Rft1 UTSW 14 30677804 missense probably benign 0.04
R5256:Rft1 UTSW 14 30661286 missense probably benign 0.03
R5382:Rft1 UTSW 14 30666782 missense probably benign 0.04
R5719:Rft1 UTSW 14 30663226 intron probably benign
R7200:Rft1 UTSW 14 30682857 critical splice donor site probably null
R7652:Rft1 UTSW 14 30677816 missense probably benign 0.15
R7657:Rft1 UTSW 14 30666767 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGAGCTTTCAGCAGGTCAGC -3'
(R):5'- TCTTGTGTGGCCTCTGAGAAAAGTG -3'

Sequencing Primer
(F):5'- CAGCAAGAGATCTGTGCATTTCTG -3'
(R):5'- GTGTAGACAAATCCATGCTCAG -3'
Posted On2013-11-08