Incidental Mutation 'R0879:Oxnad1'
ID81941
Institutional Source Beutler Lab
Gene Symbol Oxnad1
Ensembl Gene ENSMUSG00000021906
Gene Nameoxidoreductase NAD-binding domain containing 1
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location32085374-32103202 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32099596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 213 (Y213N)
Ref Sequence ENSEMBL: ENSMUSP00000022462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022462] [ENSMUST00000164868] [ENSMUST00000165523] [ENSMUST00000168986] [ENSMUST00000169649] [ENSMUST00000170600] [ENSMUST00000171598] [ENSMUST00000227845]
Predicted Effect probably damaging
Transcript: ENSMUST00000022462
AA Change: Y213N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022462
Gene: ENSMUSG00000021906
AA Change: Y213N

DomainStartEndE-ValueType
Pfam:NAD_binding_6 168 269 6.5e-9 PFAM
Pfam:NAD_binding_1 173 293 8.1e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164396
Predicted Effect probably benign
Transcript: ENSMUST00000164868
SMART Domains Protein: ENSMUSP00000125791
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 149 1e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165523
Predicted Effect probably benign
Transcript: ENSMUST00000168986
SMART Domains Protein: ENSMUSP00000126372
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 130 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169078
Predicted Effect probably benign
Transcript: ENSMUST00000169649
Predicted Effect probably benign
Transcript: ENSMUST00000170519
SMART Domains Protein: ENSMUSP00000132560
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 2 78 8e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170600
SMART Domains Protein: ENSMUSP00000130998
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 143 3e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171598
SMART Domains Protein: ENSMUSP00000132162
Gene: ENSMUSG00000021906

DomainStartEndE-ValueType
SCOP:d1ep3b1 65 115 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171849
Predicted Effect probably benign
Transcript: ENSMUST00000227845
Meta Mutation Damage Score 0.9555 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Oxnad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0480:Oxnad1 UTSW 14 32099480 missense probably damaging 1.00
R1482:Oxnad1 UTSW 14 32099633 critical splice donor site probably null
R1526:Oxnad1 UTSW 14 32102287 missense probably benign 0.00
R4649:Oxnad1 UTSW 14 32102409 makesense probably null
R4703:Oxnad1 UTSW 14 32095470 missense probably damaging 1.00
R6411:Oxnad1 UTSW 14 32091652 missense possibly damaging 0.92
R6980:Oxnad1 UTSW 14 32085619 unclassified probably benign
R7117:Oxnad1 UTSW 14 32091651 missense probably benign 0.00
R7167:Oxnad1 UTSW 14 32101019 nonsense probably null
R7197:Oxnad1 UTSW 14 32096516 missense possibly damaging 0.50
R7809:Oxnad1 UTSW 14 32101005 missense probably benign
X0020:Oxnad1 UTSW 14 32091761 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTTTGACCCTCAGCCCACAGATG -3'
(R):5'- ATCAGGCACTTCGGCCATACTCAC -3'

Sequencing Primer
(F):5'- GATGCCCCTCGAAACCTC -3'
(R):5'- GGTTGCTCACTCTACCATACAC -3'
Posted On2013-11-08