Incidental Mutation 'R0879:C6'
ID81943
Institutional Source Beutler Lab
Gene Symbol C6
Ensembl Gene ENSMUSG00000022181
Gene Namecomplement component 6
Synonyms
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4727175-4814967 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 4763336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022788] [ENSMUST00000161997] [ENSMUST00000162350] [ENSMUST00000162585]
Predicted Effect probably benign
Transcript: ENSMUST00000022788
SMART Domains Protein: ENSMUSP00000022788
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161997
SMART Domains Protein: ENSMUSP00000125358
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
Blast:TSP1 197 223 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162350
SMART Domains Protein: ENSMUSP00000125693
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Blast:FIMAC 859 931 1e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162585
SMART Domains Protein: ENSMUSP00000124417
Gene: ENSMUSG00000022181

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSP1 26 79 1.68e-11 SMART
TSP1 84 134 1.05e-3 SMART
LDLa 139 175 1.46e-11 SMART
MACPF 312 516 1.89e-59 SMART
TSP1 568 617 3.9e-7 SMART
CCP 644 699 1.21e-9 SMART
CCP 704 761 3.56e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162729
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the complement cascade. The encoded protein is part of the membrane attack complex that can be incorporated into the cell membrane and cause cell lysis. Mutations in this gene are associated with complement component-6 deficiency. Transcript variants encoding the same protein have been described.[provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit decreased susceptibility to ischemia reperfusion-induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in C6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:C6 APN 15 4759967 missense possibly damaging 0.53
IGL00918:C6 APN 15 4735257 missense possibly damaging 0.90
IGL01615:C6 APN 15 4781896 missense probably benign 0.00
IGL01637:C6 APN 15 4759917 missense possibly damaging 0.69
IGL01662:C6 APN 15 4792754 missense probably damaging 1.00
IGL02293:C6 APN 15 4755303 missense probably benign 0.01
IGL02431:C6 APN 15 4759861 nonsense probably null
IGL02568:C6 APN 15 4791164 nonsense probably null
IGL02688:C6 APN 15 4798320 missense probably benign 0.00
IGL02737:C6 APN 15 4796914 missense probably benign 0.30
R0195:C6 UTSW 15 4763471 missense probably benign 0.01
R0334:C6 UTSW 15 4755367 missense probably benign 0.24
R0940:C6 UTSW 15 4735235 missense probably benign 0.12
R1342:C6 UTSW 15 4739749 splice site probably benign
R1649:C6 UTSW 15 4735257 missense possibly damaging 0.90
R1709:C6 UTSW 15 4790970 missense probably benign 0.34
R1967:C6 UTSW 15 4759820 missense probably damaging 0.99
R2068:C6 UTSW 15 4791070 missense probably damaging 1.00
R3056:C6 UTSW 15 4739873 missense probably damaging 0.99
R3791:C6 UTSW 15 4735235 missense probably benign 0.00
R3821:C6 UTSW 15 4789584 missense probably benign 0.23
R3895:C6 UTSW 15 4808470 missense probably benign 0.00
R4178:C6 UTSW 15 4735139 missense probably benign 0.02
R4440:C6 UTSW 15 4735251 missense possibly damaging 0.90
R4598:C6 UTSW 15 4763370 missense possibly damaging 0.55
R4632:C6 UTSW 15 4759868 missense probably benign 0.01
R4756:C6 UTSW 15 4781912 missense probably benign
R4879:C6 UTSW 15 4803647 unclassified probably null
R5452:C6 UTSW 15 4814829 missense possibly damaging 0.51
R5538:C6 UTSW 15 4814829 missense possibly damaging 0.84
R5547:C6 UTSW 15 4808488 missense probably benign 0.00
R5790:C6 UTSW 15 4763486 missense probably damaging 1.00
R5862:C6 UTSW 15 4735263 missense possibly damaging 0.66
R5946:C6 UTSW 15 4808514 missense possibly damaging 0.96
R6049:C6 UTSW 15 4735172 missense probably damaging 1.00
R6247:C6 UTSW 15 4763541 missense probably damaging 1.00
R6438:C6 UTSW 15 4796983 missense possibly damaging 0.94
R6873:C6 UTSW 15 4790979 missense probably benign 0.03
R7052:C6 UTSW 15 4733695 missense probably damaging 0.97
R7302:C6 UTSW 15 4796950 missense probably damaging 1.00
R7361:C6 UTSW 15 4796922 nonsense probably null
R7481:C6 UTSW 15 4814875 missense
R7492:C6 UTSW 15 4731714 missense probably benign 0.00
R7498:C6 UTSW 15 4763364 missense probably damaging 1.00
R7569:C6 UTSW 15 4789581 missense probably benign 0.01
R7653:C6 UTSW 15 4814762 missense
R7666:C6 UTSW 15 4789505 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GATACTGGAGTGCAGCCTGAAGAC -3'
(R):5'- CCTGGCGGCTGAATTGGTAGATAAG -3'

Sequencing Primer
(F):5'- TGCAGTAGGAATGGGGCTAA -3'
(R):5'- GGTAGATAAGGTCATACTTGCCCC -3'
Posted On2013-11-08