Incidental Mutation 'R0879:Vmn2r102'
ID81946
Institutional Source Beutler Lab
Gene Symbol Vmn2r102
Ensembl Gene ENSMUSG00000095961
Gene Namevomeronasal 2, receptor 102
SynonymsEG224572
MMRRC Submission 039046-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19660399-19694748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19694192 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 673 (V673A)
Ref Sequence ENSEMBL: ENSMUSP00000126559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171741]
Predicted Effect probably damaging
Transcript: ENSMUST00000171741
AA Change: V673A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126559
Gene: ENSMUSG00000095961
AA Change: V673A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 448 5.2e-38 PFAM
Pfam:NCD3G 509 562 1.1e-21 PFAM
Pfam:7tm_3 595 830 1.8e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
Brd2 A T 17: 34,113,446 V232D probably benign Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Vmn2r102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Vmn2r102 APN 17 19678892 missense probably damaging 1.00
IGL00974:Vmn2r102 APN 17 19677509 missense possibly damaging 0.93
IGL00978:Vmn2r102 APN 17 19678923 splice site probably null
IGL01589:Vmn2r102 APN 17 19678804 missense probably benign
IGL01738:Vmn2r102 APN 17 19677758 missense probably damaging 1.00
IGL01994:Vmn2r102 APN 17 19660469 missense probably benign 0.00
IGL02066:Vmn2r102 APN 17 19693929 missense probably benign 0.01
IGL02525:Vmn2r102 APN 17 19681185 missense probably benign
IGL02589:Vmn2r102 APN 17 19681218 missense probably damaging 1.00
IGL02814:Vmn2r102 APN 17 19677908 missense probably damaging 1.00
IGL03028:Vmn2r102 APN 17 19694066 missense possibly damaging 0.92
IGL03162:Vmn2r102 APN 17 19694024 missense probably damaging 1.00
PIT4431001:Vmn2r102 UTSW 17 19676696 missense possibly damaging 0.68
R0042:Vmn2r102 UTSW 17 19660589 missense probably damaging 0.98
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0131:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0132:Vmn2r102 UTSW 17 19678763 missense probably benign 0.42
R0268:Vmn2r102 UTSW 17 19677850 missense probably benign 0.00
R0441:Vmn2r102 UTSW 17 19694368 missense probably damaging 1.00
R0583:Vmn2r102 UTSW 17 19676781 missense probably benign 0.01
R0600:Vmn2r102 UTSW 17 19678015 missense probably benign 0.00
R0606:Vmn2r102 UTSW 17 19678844 missense possibly damaging 0.93
R0674:Vmn2r102 UTSW 17 19677867 missense probably benign 0.00
R0709:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R1349:Vmn2r102 UTSW 17 19660625 splice site probably benign
R1473:Vmn2r102 UTSW 17 19694581 missense probably benign 0.00
R1630:Vmn2r102 UTSW 17 19678770 missense possibly damaging 0.60
R1727:Vmn2r102 UTSW 17 19677508 missense probably damaging 0.99
R1759:Vmn2r102 UTSW 17 19694493 missense probably damaging 1.00
R1809:Vmn2r102 UTSW 17 19677619 missense probably benign 0.01
R2013:Vmn2r102 UTSW 17 19676744 missense probably benign 0.03
R2086:Vmn2r102 UTSW 17 19676687 missense probably damaging 1.00
R2241:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R2378:Vmn2r102 UTSW 17 19694668 missense probably damaging 1.00
R3814:Vmn2r102 UTSW 17 19678831 missense probably damaging 0.98
R3827:Vmn2r102 UTSW 17 19694525 missense probably damaging 1.00
R4159:Vmn2r102 UTSW 17 19677826 missense probably damaging 1.00
R4505:Vmn2r102 UTSW 17 19660583 missense probably benign 0.00
R4515:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4517:Vmn2r102 UTSW 17 19681213 missense probably damaging 1.00
R4534:Vmn2r102 UTSW 17 19694713 missense probably benign
R4535:Vmn2r102 UTSW 17 19694713 missense probably benign
R4662:Vmn2r102 UTSW 17 19681162 missense probably damaging 1.00
R4708:Vmn2r102 UTSW 17 19694314 missense probably benign 0.00
R4734:Vmn2r102 UTSW 17 19677533 missense probably damaging 1.00
R4834:Vmn2r102 UTSW 17 19677941 missense probably damaging 0.99
R4927:Vmn2r102 UTSW 17 19660399 start codon destroyed probably benign 0.00
R5077:Vmn2r102 UTSW 17 19677572 missense probably benign 0.20
R5181:Vmn2r102 UTSW 17 19676741 missense probably benign 0.00
R5277:Vmn2r102 UTSW 17 19694131 missense possibly damaging 0.49
R5418:Vmn2r102 UTSW 17 19694153 missense probably damaging 1.00
R5810:Vmn2r102 UTSW 17 19677542 missense probably benign 0.20
R5864:Vmn2r102 UTSW 17 19694681 missense possibly damaging 0.55
R6168:Vmn2r102 UTSW 17 19694140 missense possibly damaging 0.83
R6266:Vmn2r102 UTSW 17 19678745 missense probably benign
R6432:Vmn2r102 UTSW 17 19681221 missense possibly damaging 0.61
R6487:Vmn2r102 UTSW 17 19677907 missense probably damaging 1.00
R6597:Vmn2r102 UTSW 17 19694188 missense probably damaging 0.99
R6797:Vmn2r102 UTSW 17 19660432 nonsense probably null
R7009:Vmn2r102 UTSW 17 19694194 missense probably damaging 0.99
R7098:Vmn2r102 UTSW 17 19694408 missense probably damaging 1.00
R7134:Vmn2r102 UTSW 17 19677487 missense probably benign 0.01
R7463:Vmn2r102 UTSW 17 19676624 missense probably damaging 1.00
R7511:Vmn2r102 UTSW 17 19681143 missense probably damaging 1.00
R7512:Vmn2r102 UTSW 17 19694101 missense probably damaging 1.00
R7556:Vmn2r102 UTSW 17 19677831 missense probably benign
R8126:Vmn2r102 UTSW 17 19660450 missense probably benign 0.02
R8385:Vmn2r102 UTSW 17 19693826 missense possibly damaging 0.89
Z1176:Vmn2r102 UTSW 17 19694043 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCGAGACACTCCGATTGTAAAGG -3'
(R):5'- TGCTGTGCTGGAAGCCAAGATAG -3'

Sequencing Primer
(F):5'- TTGTAAAGGCGAATAATCGAGC -3'
(R):5'- ATGGTGTAACTCCCAAGGGC -3'
Posted On2013-11-08