Incidental Mutation 'R0879:Brd2'
ID81947
Institutional Source Beutler Lab
Gene Symbol Brd2
Ensembl Gene ENSMUSG00000024335
Gene Namebromodomain containing 2
SynonymsFrg-1, Fsrg1, D17H6S113E, Ring3, Rnf3
MMRRC Submission 039046-MU
Accession Numbers

Genbank: NM_010238, NM_001025387; MGI: 99495

 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0879 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34112023-34122634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34113446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 232 (V232D)
Ref Sequence ENSEMBL: ENSMUSP00000092990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025193] [ENSMUST00000095347] [ENSMUST00000114242] [ENSMUST00000151986] [ENSMUST00000154232]
Predicted Effect probably benign
Transcript: ENSMUST00000025193
AA Change: V624D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025193
Gene: ENSMUSG00000024335
AA Change: V624D

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
PDB:2JNS|A 635 712 3e-37 PDB
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095347
AA Change: V232D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000092990
Gene: ENSMUSG00000024335
AA Change: V232D

DomainStartEndE-ValueType
BROMO 25 135 1.3e-45 SMART
low complexity region 210 230 N/A INTRINSIC
low complexity region 238 244 N/A INTRINSIC
low complexity region 248 258 N/A INTRINSIC
BROMO 299 408 6.8e-50 SMART
coiled coil region 440 491 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
low complexity region 537 547 N/A INTRINSIC
PDB:2JNS|A 589 666 2e-37 PDB
coiled coil region 675 704 N/A INTRINSIC
low complexity region 726 751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114242
AA Change: V624D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109880
Gene: ENSMUSG00000024335
AA Change: V624D

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
coiled coil region 486 537 N/A INTRINSIC
low complexity region 542 560 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
Pfam:BET 639 703 7.4e-35 PFAM
coiled coil region 721 750 N/A INTRINSIC
low complexity region 772 797 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148143
Predicted Effect probably benign
Transcript: ENSMUST00000151986
SMART Domains Protein: ENSMUSP00000117359
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
BROMO 71 181 2.13e-43 SMART
low complexity region 256 276 N/A INTRINSIC
low complexity region 284 290 N/A INTRINSIC
low complexity region 294 304 N/A INTRINSIC
BROMO 345 454 1.13e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154232
SMART Domains Protein: ENSMUSP00000128835
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
low complexity region 50 71 N/A INTRINSIC
Blast:BROMO 72 110 4e-21 BLAST
PDB:3AQA|C 72 110 2e-22 PDB
SCOP:d1f68a_ 76 103 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155286
Predicted Effect probably benign
Transcript: ENSMUST00000173032
SMART Domains Protein: ENSMUSP00000134608
Gene: ENSMUSG00000024335

DomainStartEndE-ValueType
Pfam:Bromodomain 1 43 1.4e-6 PFAM
coiled coil region 73 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173204
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with decreased embryo size, decreased cell proliferation, a delay in the cell cycle, and increased cell death. Heterozygous mice also display decreased cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, other(2) Gene trapped(14)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,617,610 probably benign Het
Adm A G 7: 110,628,352 D25G possibly damaging Het
Adprhl2 C T 4: 126,316,617 V357I probably benign Het
Akap6 G T 12: 52,880,799 R164L probably damaging Het
Baz2a A G 10: 128,121,304 N972S probably damaging Het
C6 A G 15: 4,763,336 probably benign Het
Ceacam5 A C 7: 17,757,702 I666L probably benign Het
Col7a1 T C 9: 108,976,091 probably benign Het
Dnah17 C T 11: 118,056,835 probably benign Het
Dnah7a A T 1: 53,427,860 V3615E possibly damaging Het
Eml6 A G 11: 29,850,816 probably null Het
Enpp2 T C 15: 54,877,930 E324G probably damaging Het
Fgd4 A G 16: 16,477,449 V222A probably damaging Het
Gm4076 A G 13: 85,127,207 noncoding transcript Het
Gm4775 T C 14: 106,100,793 noncoding transcript Het
Igsf9b T C 9: 27,333,742 S1002P probably damaging Het
Jag1 A G 2: 137,100,081 S244P possibly damaging Het
Klhl41 A T 2: 69,683,483 probably benign Het
Ltbr A G 6: 125,313,375 probably benign Het
Megf8 A G 7: 25,338,471 E804G possibly damaging Het
Mybpc1 G A 10: 88,571,516 probably benign Het
Npas4 T C 19: 4,986,916 R407G probably benign Het
Oxnad1 T A 14: 32,099,596 Y213N probably damaging Het
Pde6d A G 1: 86,545,801 F91S probably benign Het
Pelp1 A G 11: 70,395,297 probably benign Het
Plscr2 T C 9: 92,287,793 Y99H probably damaging Het
Rft1 T C 14: 30,682,748 probably benign Het
Ryr3 T C 2: 113,030,243 Y30C probably benign Het
Selenbp2 A G 3: 94,699,556 T108A possibly damaging Het
Stk32b A G 5: 37,459,596 probably benign Het
Stra6 T C 9: 58,135,204 probably null Het
Usp17le A T 7: 104,769,647 L96Q probably damaging Het
Usp17le G T 7: 104,769,648 L96M possibly damaging Het
Vmn1r76 A T 7: 11,930,735 I184N probably benign Het
Vmn2r102 T C 17: 19,694,192 V673A probably damaging Het
Wdr17 T G 8: 54,661,481 I667L probably benign Het
Zfp292 T C 4: 34,811,218 T609A probably benign Het
Zfp821 T C 8: 109,721,842 I135T possibly damaging Het
Zfp865 A G 7: 5,031,343 T776A probably benign Het
Zp2 G T 7: 120,135,534 P477Q probably damaging Het
Other mutations in Brd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd2 APN 17 34114423 missense probably damaging 1.00
IGL01589:Brd2 APN 17 34117042 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117002 missense probably damaging 1.00
IGL01724:Brd2 APN 17 34117001 missense probably damaging 1.00
IGL02043:Brd2 APN 17 34112616 unclassified probably benign
crater UTSW 17 34113259 missense probably damaging 0.96
FR4449:Brd2 UTSW 17 34116336 unclassified probably benign
FR4548:Brd2 UTSW 17 34116336 unclassified probably benign
R0085:Brd2 UTSW 17 34113259 missense probably damaging 0.96
R0497:Brd2 UTSW 17 34114360 missense probably damaging 1.00
R1150:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1152:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R1280:Brd2 UTSW 17 34114150 missense possibly damaging 0.91
R1426:Brd2 UTSW 17 34114007 utr 3 prime probably benign
R2247:Brd2 UTSW 17 34114415 missense probably damaging 1.00
R3737:Brd2 UTSW 17 34117080 missense probably benign 0.10
R5286:Brd2 UTSW 17 34115231 missense probably damaging 0.97
R5673:Brd2 UTSW 17 34112607 unclassified probably benign
R6134:Brd2 UTSW 17 34113695 missense probably benign 0.00
R6318:Brd2 UTSW 17 34112898 missense probably damaging 1.00
R7257:Brd2 UTSW 17 34113822 missense probably damaging 1.00
R7493:Brd2 UTSW 17 34122257 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCGCTCAAGCTCTCTAAGTGTGGAC -3'
(R):5'- ATCGTGGCCGAATTGGGATCGATG -3'

Sequencing Primer
(F):5'- GACGGCTTGAGTGTTTCAAAATC -3'
(R):5'- TAGCAATGCTACTACACTCAGC -3'
Posted On2013-11-08