Incidental Mutation 'R0879:Npas4'
ID 81948
Institutional Source Beutler Lab
Gene Symbol Npas4
Ensembl Gene ENSMUSG00000045903
Gene Name neuronal PAS domain protein 4
Synonyms Nxf, LE-PAS, Npas4
MMRRC Submission 039046-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.627) question?
Stock # R0879 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 5034383-5040344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 5036944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 407 (R407G)
Ref Sequence ENSEMBL: ENSMUSP00000062992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056129]
AlphaFold Q8BGD7
Predicted Effect probably benign
Transcript: ENSMUST00000056129
AA Change: R407G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062992
Gene: ENSMUSG00000045903
AA Change: R407G

DomainStartEndE-ValueType
Blast:HLH 6 56 1e-26 BLAST
low complexity region 57 69 N/A INTRINSIC
PAS 72 140 1.88e-6 SMART
low complexity region 197 211 N/A INTRINSIC
PAS 213 273 5.66e-1 SMART
internal_repeat_1 394 473 1.35e-6 PROSPERO
internal_repeat_1 467 556 1.35e-6 PROSPERO
low complexity region 657 676 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.3%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NXF is a member of the basic helix-loop-helix-PER (MIM 602260)-ARNT (MIM 126110)-SIM (see SIM2; MIM 600892) (bHLH-PAS) class of transcriptional regulators, which are involved in a wide range of physiologic and developmental events (Ooe et al., 2004 [PubMed 14701734]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aagab T A 9: 63,524,892 (GRCm39) probably benign Het
Adm A G 7: 110,227,559 (GRCm39) D25G possibly damaging Het
Adprs C T 4: 126,210,410 (GRCm39) V357I probably benign Het
Akap6 G T 12: 52,927,582 (GRCm39) R164L probably damaging Het
Baz2a A G 10: 127,957,173 (GRCm39) N972S probably damaging Het
Brd2 A T 17: 34,332,420 (GRCm39) V232D probably benign Het
C6 A G 15: 4,792,818 (GRCm39) probably benign Het
Ceacam5 A C 7: 17,491,627 (GRCm39) I666L probably benign Het
Col7a1 T C 9: 108,805,159 (GRCm39) probably benign Het
Dnah17 C T 11: 117,947,661 (GRCm39) probably benign Het
Dnah7a A T 1: 53,467,019 (GRCm39) V3615E possibly damaging Het
Eml6 A G 11: 29,800,816 (GRCm39) probably null Het
Enpp2 T C 15: 54,741,326 (GRCm39) E324G probably damaging Het
Fgd4 A G 16: 16,295,313 (GRCm39) V222A probably damaging Het
Gm4076 A G 13: 85,275,326 (GRCm39) noncoding transcript Het
Gm4775 T C 14: 106,338,227 (GRCm39) noncoding transcript Het
Igsf9b T C 9: 27,245,038 (GRCm39) S1002P probably damaging Het
Jag1 A G 2: 136,942,001 (GRCm39) S244P possibly damaging Het
Klhl41 A T 2: 69,513,827 (GRCm39) probably benign Het
Ltbr A G 6: 125,290,338 (GRCm39) probably benign Het
Megf8 A G 7: 25,037,896 (GRCm39) E804G possibly damaging Het
Mybpc1 G A 10: 88,407,378 (GRCm39) probably benign Het
Oxnad1 T A 14: 31,821,553 (GRCm39) Y213N probably damaging Het
Pde6d A G 1: 86,473,523 (GRCm39) F91S probably benign Het
Pelp1 A G 11: 70,286,123 (GRCm39) probably benign Het
Plscr2 T C 9: 92,169,846 (GRCm39) Y99H probably damaging Het
Rft1 T C 14: 30,404,705 (GRCm39) probably benign Het
Ryr3 T C 2: 112,860,588 (GRCm39) Y30C probably benign Het
Selenbp2 A G 3: 94,606,863 (GRCm39) T108A possibly damaging Het
Stk32b A G 5: 37,616,940 (GRCm39) probably benign Het
Stra6 T C 9: 58,042,487 (GRCm39) probably null Het
Usp17le A T 7: 104,418,854 (GRCm39) L96Q probably damaging Het
Usp17le G T 7: 104,418,855 (GRCm39) L96M possibly damaging Het
Vmn1r76 A T 7: 11,664,662 (GRCm39) I184N probably benign Het
Vmn2r102 T C 17: 19,914,454 (GRCm39) V673A probably damaging Het
Wdr17 T G 8: 55,114,516 (GRCm39) I667L probably benign Het
Zfp292 T C 4: 34,811,218 (GRCm39) T609A probably benign Het
Zfp821 T C 8: 110,448,474 (GRCm39) I135T possibly damaging Het
Zfp865 A G 7: 5,034,342 (GRCm39) T776A probably benign Het
Zp2 G T 7: 119,734,757 (GRCm39) P477Q probably damaging Het
Other mutations in Npas4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Npas4 APN 19 5,037,355 (GRCm39) missense possibly damaging 0.93
IGL01865:Npas4 APN 19 5,035,819 (GRCm39) nonsense probably null
IGL02746:Npas4 APN 19 5,036,695 (GRCm39) missense probably damaging 0.99
IGL03061:Npas4 APN 19 5,036,365 (GRCm39) missense probably damaging 1.00
IGL03340:Npas4 APN 19 5,035,094 (GRCm39) utr 3 prime probably benign
R0920:Npas4 UTSW 19 5,036,344 (GRCm39) nonsense probably null
R1751:Npas4 UTSW 19 5,038,211 (GRCm39) missense probably benign 0.05
R1767:Npas4 UTSW 19 5,038,211 (GRCm39) missense probably benign 0.05
R2066:Npas4 UTSW 19 5,037,442 (GRCm39) missense probably damaging 0.99
R2201:Npas4 UTSW 19 5,037,392 (GRCm39) missense probably benign 0.06
R3973:Npas4 UTSW 19 5,036,579 (GRCm39) missense probably benign
R4117:Npas4 UTSW 19 5,037,391 (GRCm39) missense probably damaging 0.99
R4846:Npas4 UTSW 19 5,036,805 (GRCm39) missense probably benign 0.34
R5007:Npas4 UTSW 19 5,039,684 (GRCm39) missense possibly damaging 0.61
R6155:Npas4 UTSW 19 5,036,898 (GRCm39) missense probably damaging 1.00
R6255:Npas4 UTSW 19 5,036,403 (GRCm39) missense probably damaging 1.00
R6488:Npas4 UTSW 19 5,036,011 (GRCm39) missense probably damaging 1.00
R8427:Npas4 UTSW 19 5,036,108 (GRCm39) missense probably benign
R8864:Npas4 UTSW 19 5,038,556 (GRCm39) missense probably damaging 1.00
R9449:Npas4 UTSW 19 5,038,492 (GRCm39) missense probably damaging 1.00
R9573:Npas4 UTSW 19 5,035,837 (GRCm39) missense probably benign 0.19
Z1177:Npas4 UTSW 19 5,036,270 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGTGCATGGAGTCAACTGGTC -3'
(R):5'- TCCGCCAGCAGCTAAACTCTGAAG -3'

Sequencing Primer
(F):5'- GAGTCAACTGGTCTTCAAAGC -3'
(R):5'- GACACCCAGGCAGCCTATG -3'
Posted On 2013-11-08