Mutagenetix > Incidental Mutation

Incidental Mutation 'R0943:Tbc1d32'

81972

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d32

Ensembl Gene

ENSMUSG00000038122

Gene Name

TBC1 domain family, member 32

Synonyms

D630037F22Rik, C6orf170, Bromi, b2b2284Clo

MMRRC Submission

039082-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.903) question?

Stock #

R0943 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56014293-56228689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56161147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 667 (V667E)

Ref Sequence

ENSEMBL: ENSMUSP00000097328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099739]

AlphaFold

Q3URV1

Predicted Effect

probably benign
Transcript: ENSMUST00000099739
AA Change: V667E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000097328
Gene: ENSMUSG00000038122
AA Change: V667E

Domain	Start	End	E-Value	Type
Pfam:BROMI	12	1293	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217792

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219385

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TBC-domain containing protein. Studies of a similar protein in mouse and zebrafish suggest that the encoded protein is involved in sonic hedgehog signaling, and that it interacts with and stabilizes cell cycle-related kinase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trap allele or ENU induced mutation exhibit exencephaly and poor eye development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	C	T	2: 85,488,765	D398N	probably damaging	Het
A230050P20Rik	A	T	9: 20,872,962	H160L	possibly damaging	Het
Agtpbp1	T	C	13: 59,500,602	N468S	probably benign	Het
Card6	A	G	15: 5,100,286	S543P	probably damaging	Het
Celsr1	T	G	15: 85,903,288	T2750P	probably damaging	Het
Csmd3	A	G	15: 47,675,739	M2341T	probably damaging	Het
Dym	A	G	18: 75,286,769	*670W	probably null	Het
Ehbp1	T	C	11: 22,095,883	D597G	probably benign	Het
Emx1	G	A	6: 85,203,919	W206*	probably null	Het
Esr1	A	G	10: 4,746,781	K210R	probably damaging	Het
Extl1	TGCGTTGCACCGATACCGGG	TG	4: 134,357,677		probably benign	Het
Fam72a	T	C	1: 131,528,779	S27P	possibly damaging	Het
Fanca	A	T	8: 123,274,186	C1152S	probably damaging	Het
Fras1	G	A	5: 96,726,543	V2276I	probably benign	Het
Gm9008	T	C	6: 76,496,415	H406R	probably benign	Het
Hoxb13	A	G	11: 96,195,973	E202G	probably benign	Het
Lcmt1	T	G	7: 123,401,439		probably null	Het
Mettl7a1	T	C	15: 100,304,958	Y20H	probably benign	Het
Nars2	C	T	7: 96,955,931		probably benign	Het
Neil3	ATATTTATTTATTTATTTATTTATTTATTTATT	ATATTTATTTATTTATTTATTTATTTATTTATTTATT	8: 53,609,369		probably benign	Het
Nup153	T	C	13: 46,696,772		probably benign	Het
Olfr1257	T	C	2: 89,880,961	V45A	probably benign	Het
Olfr1466	C	A	19: 13,341,793	H12N	probably benign	Het
Prkar2a	T	C	9: 108,733,276		probably benign	Het
Ptprc	T	C	1: 138,111,164	T209A	probably damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rprd2	C	T	3: 95,784,247	V239I	possibly damaging	Het
Sgo2b	A	G	8: 63,931,335	F209S	possibly damaging	Het
Spry2	T	C	14: 105,893,587	Y55C	probably damaging	Het
Tbrg4	A	G	11: 6,619,008	F388L	probably damaging	Het
Tshz1	T	C	18: 84,015,231	T351A	probably benign	Het
Usp48	A	G	4: 137,644,470	N969S	possibly damaging	Het
Vmn2r108	A	T	17: 20,471,135	C375*	probably null	Het
Vps45	T	A	3: 96,057,024	I62F	probably benign	Het
Xab2	A	G	8: 3,613,667	F388L	probably benign	Het
Zfp735	A	G	11: 73,712,083	T618A	probably benign	Het
Zswim2	T	A	2: 83,917,998	R279S	possibly damaging	Het

Other mutations in Tbc1d32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Tbc1d32	APN	10	56155765	missense	probably damaging	1.00
IGL00535:Tbc1d32	APN	10	56215125	splice site	probably benign
IGL00835:Tbc1d32	APN	10	56089846	splice site	probably benign
IGL01013:Tbc1d32	APN	10	56201959	splice site	probably null
IGL01306:Tbc1d32	APN	10	56180524	missense	probably benign	0.14
IGL01452:Tbc1d32	APN	10	56215080	missense	possibly damaging	0.71
IGL01668:Tbc1d32	APN	10	56123577	missense	probably benign	0.37
IGL02008:Tbc1d32	APN	10	56151775	missense	possibly damaging	0.71
IGL02076:Tbc1d32	APN	10	56088403	missense	possibly damaging	0.93
IGL02348:Tbc1d32	APN	10	56224619	missense	probably benign	0.06
IGL02476:Tbc1d32	APN	10	56198542	missense	possibly damaging	0.71
IGL02750:Tbc1d32	APN	10	56198491	missense	possibly damaging	0.95
IGL02893:Tbc1d32	APN	10	56017703	missense	probably damaging	0.98
ANU23:Tbc1d32	UTSW	10	56180524	missense	probably benign	0.14
P0035:Tbc1d32	UTSW	10	56198439	missense	probably damaging	1.00
R0118:Tbc1d32	UTSW	10	56017605	missense	probably benign	0.02
R0446:Tbc1d32	UTSW	10	56192898	missense	possibly damaging	0.93
R0567:Tbc1d32	UTSW	10	56173963	missense	possibly damaging	0.71
R0615:Tbc1d32	UTSW	10	56224640	missense	probably benign	0.33
R0679:Tbc1d32	UTSW	10	56180576	missense	probably damaging	0.99
R1432:Tbc1d32	UTSW	10	56017662	missense	probably damaging	0.99
R1454:Tbc1d32	UTSW	10	56177479	splice site	probably benign
R1708:Tbc1d32	UTSW	10	56151769	missense	possibly damaging	0.84
R1834:Tbc1d32	UTSW	10	56017604	missense	probably benign	0.00
R1860:Tbc1d32	UTSW	10	56123537	nonsense	probably null
R2208:Tbc1d32	UTSW	10	56150792	critical splice donor site	probably null
R3012:Tbc1d32	UTSW	10	56173915	missense	probably benign	0.08
R3736:Tbc1d32	UTSW	10	56129093	missense	probably damaging	0.99
R4184:Tbc1d32	UTSW	10	56224580	missense	probably benign	0.15
R4259:Tbc1d32	UTSW	10	56049771	missense	probably damaging	0.97
R4617:Tbc1d32	UTSW	10	56170904	missense	possibly damaging	0.92
R4700:Tbc1d32	UTSW	10	56224649	missense	probably damaging	0.98
R4794:Tbc1d32	UTSW	10	56196836	missense	possibly damaging	0.92
R4879:Tbc1d32	UTSW	10	56049029	splice site	probably null
R5031:Tbc1d32	UTSW	10	56123531	missense	probably damaging	0.98
R5036:Tbc1d32	UTSW	10	56195404	nonsense	probably null
R5276:Tbc1d32	UTSW	10	56151818	missense	probably damaging	0.99
R5358:Tbc1d32	UTSW	10	56170937	missense	possibly damaging	0.93
R5429:Tbc1d32	UTSW	10	56027993	missense	probably damaging	0.99
R5435:Tbc1d32	UTSW	10	56040150	missense	probably damaging	0.98
R5451:Tbc1d32	UTSW	10	56195475	missense	possibly damaging	0.95
R5607:Tbc1d32	UTSW	10	56129150	missense	possibly damaging	0.92
R5642:Tbc1d32	UTSW	10	56150877	missense	possibly damaging	0.82
R5732:Tbc1d32	UTSW	10	56088393	missense	probably damaging	0.99
R5795:Tbc1d32	UTSW	10	56215062	missense	possibly damaging	0.71
R5988:Tbc1d32	UTSW	10	56088337	missense	probably damaging	0.98
R6054:Tbc1d32	UTSW	10	56162208	missense	possibly damaging	0.95
R6103:Tbc1d32	UTSW	10	56150883	missense	probably damaging	0.99
R6277:Tbc1d32	UTSW	10	56195429	missense	probably benign
R6422:Tbc1d32	UTSW	10	56028061	nonsense	probably null
R6508:Tbc1d32	UTSW	10	56224690	missense	probably damaging	0.98
R6859:Tbc1d32	UTSW	10	56180530	missense	probably damaging	0.98
R6887:Tbc1d32	UTSW	10	56151811	nonsense	probably null
R7012:Tbc1d32	UTSW	10	56224724	missense	probably damaging	0.99
R7253:Tbc1d32	UTSW	10	56198441	missense	probably benign
R7288:Tbc1d32	UTSW	10	56051387	critical splice donor site	probably null
R7599:Tbc1d32	UTSW	10	56151833	missense	possibly damaging	0.92
R8338:Tbc1d32	UTSW	10	56028077	missense	possibly damaging	0.85
R8814:Tbc1d32	UTSW	10	56196592	missense	possibly damaging	0.93
R8864:Tbc1d32	UTSW	10	56087559	missense	probably benign	0.01
R9018:Tbc1d32	UTSW	10	56072597	missense	probably benign	0.02
R9030:Tbc1d32	UTSW	10	56161145	missense	possibly damaging	0.92
R9530:Tbc1d32	UTSW	10	56196411	missense	probably damaging	0.98
R9616:Tbc1d32	UTSW	10	56161150	missense	possibly damaging	0.85
Z1188:Tbc1d32	UTSW	10	56170881	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCATCCATGCAAGATCCCTTACCAGTT -3'
(R):5'- ACTTCAGAACCTCCTTCTCAGTAGAGC -3'

Sequencing Primer
(F):5'- ACAGGATGAGGTAAAAACTATTCAC -3'
(R):5'- CTCAGTAGAGCTAGGGTCTAAGTC -3'

Posted On

2013-11-08