Incidental Mutation 'R0943:Tbrg4'
ID81973
Institutional Source Beutler Lab
Gene Symbol Tbrg4
Ensembl Gene ENSMUSG00000000384
Gene Nametransforming growth factor beta regulated gene 4
Synonyms2310042P22Rik, TB-12, Cpr2
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6615598-6626067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6619008 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 388 (F388L)
Ref Sequence ENSEMBL: ENSMUSP00000140835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000394] [ENSMUST00000136682] [ENSMUST00000144463] [ENSMUST00000150697] [ENSMUST00000156969] [ENSMUST00000189268]
Predicted Effect probably damaging
Transcript: ENSMUST00000000394
AA Change: F388L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000394
Gene: ENSMUSG00000000384
AA Change: F388L

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 368 437 5.9e-24 PFAM
Pfam:FAST_2 450 535 7.4e-27 PFAM
RAP 562 619 4.01e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134016
Predicted Effect probably benign
Transcript: ENSMUST00000136682
SMART Domains Protein: ENSMUSP00000114174
Gene: ENSMUSG00000000384

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144463
SMART Domains Protein: ENSMUSP00000120103
Gene: ENSMUSG00000000384

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150697
SMART Domains Protein: ENSMUSP00000123131
Gene: ENSMUSG00000000384

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
SCOP:d1gw5a_ 81 250 6e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151008
Predicted Effect probably damaging
Transcript: ENSMUST00000156969
AA Change: F388L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114256
Gene: ENSMUSG00000000384
AA Change: F388L

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 367 438 1.1e-23 PFAM
Pfam:FAST_2 448 535 7.4e-29 PFAM
RAP 562 619 4.01e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189268
AA Change: F388L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140835
Gene: ENSMUSG00000000384
AA Change: F388L

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Pfam:FAST_1 367 438 1.1e-23 PFAM
Pfam:FAST_2 448 535 7.4e-29 PFAM
RAP 562 619 4.01e-10 SMART
Meta Mutation Damage Score 0.6593 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Tbrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Tbrg4 APN 11 6618522 missense possibly damaging 0.94
IGL02225:Tbrg4 APN 11 6624094 missense probably damaging 0.97
IGL02332:Tbrg4 APN 11 6618492 missense probably damaging 0.98
PIT4449001:Tbrg4 UTSW 11 6619689 missense probably damaging 1.00
PIT4453001:Tbrg4 UTSW 11 6620857 missense probably damaging 1.00
R0412:Tbrg4 UTSW 11 6623832 missense probably benign
R0732:Tbrg4 UTSW 11 6620812 missense probably benign 0.19
R3960:Tbrg4 UTSW 11 6618077 missense probably benign
R4618:Tbrg4 UTSW 11 6620185 intron probably benign
R4686:Tbrg4 UTSW 11 6618468 missense probably benign 0.00
R4767:Tbrg4 UTSW 11 6620909 missense probably benign 0.00
R5240:Tbrg4 UTSW 11 6617516 critical splice donor site probably null
R5457:Tbrg4 UTSW 11 6620947 missense probably damaging 1.00
R5898:Tbrg4 UTSW 11 6617372 missense probably damaging 0.98
R7173:Tbrg4 UTSW 11 6620810 missense possibly damaging 0.80
R7343:Tbrg4 UTSW 11 6620065 missense probably benign 0.28
R8017:Tbrg4 UTSW 11 6618517 missense probably damaging 0.99
R8019:Tbrg4 UTSW 11 6618517 missense probably damaging 0.99
R8854:Tbrg4 UTSW 11 6616691 missense probably benign 0.00
X0013:Tbrg4 UTSW 11 6617540 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GTCTCAAAGCCCTTGTGATACTCCC -3'
(R):5'- ACCTGAAGCTGCCTCTGGTTGAAC -3'

Sequencing Primer
(F):5'- CTTGTGATACTCCCCAGTGATGAAG -3'
(R):5'- TCTGGTTGAACAGTTGGAGC -3'
Posted On2013-11-08