Incidental Mutation 'R0943:Spry2'
ID81979
Institutional Source Beutler Lab
Gene Symbol Spry2
Ensembl Gene ENSMUSG00000022114
Gene Namesprouty RTK signaling antagonist 2
Synonymssprouty2
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location105891947-105896819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105893587 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 55 (Y55C)
Ref Sequence ENSEMBL: ENSMUSP00000022709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022709]
Predicted Effect probably damaging
Transcript: ENSMUST00000022709
AA Change: Y55C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022709
Gene: ENSMUSG00000022114
AA Change: Y55C

DomainStartEndE-ValueType
low complexity region 107 130 N/A INTRINSIC
Pfam:Sprouty 183 301 2.8e-38 PFAM
Meta Mutation Damage Score 0.6141 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit enteric nerve hyperplasia which led to esophangeal achalasia and intestinal pseudo-obstruction. Mice also have intermediate to severe hearing loss with abnormalities in the organ of Corti and about half die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Spry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01747:Spry2 APN 14 105893054 missense probably damaging 1.00
eagle UTSW 14 105893357 nonsense probably null
Osprey UTSW 14 105892984 missense possibly damaging 0.92
R0016:Spry2 UTSW 14 105893297 missense probably benign 0.08
R0594:Spry2 UTSW 14 105893310 missense possibly damaging 0.50
R0843:Spry2 UTSW 14 105893090 missense probably damaging 1.00
R1186:Spry2 UTSW 14 105892907 missense probably damaging 1.00
R4052:Spry2 UTSW 14 105893201 missense probably damaging 1.00
R5355:Spry2 UTSW 14 105893278 missense probably damaging 0.97
R6306:Spry2 UTSW 14 105892984 missense possibly damaging 0.92
R6822:Spry2 UTSW 14 105893357 nonsense probably null
R7347:Spry2 UTSW 14 105893512 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGGATTATTCCATCAGCAGCAG -3'
(R):5'- GGTTTCCCCAGGAGTTCAGATGTG -3'

Sequencing Primer
(F):5'- GAAGGACGGTCCTAACAGTCTC -3'
(R):5'- CCCAGGAGTTCAGATGTGTTCTAAG -3'
Posted On2013-11-08