Incidental Mutation 'R0943:Mettl7a1'
ID81983
Institutional Source Beutler Lab
Gene Symbol Mettl7a1
Ensembl Gene ENSMUSG00000054619
Gene Namemethyltransferase like 7A1
SynonymsMettl7a, 3300001H21Rik, 2210414H16Rik
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0943 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100304140-100328662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100304958 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 20 (Y20H)
Ref Sequence ENSEMBL: ENSMUSP00000155295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067752] [ENSMUST00000229217] [ENSMUST00000229574] [ENSMUST00000229588] [ENSMUST00000230018] [ENSMUST00000230252] [ENSMUST00000230472] [ENSMUST00000231166]
Predicted Effect probably benign
Transcript: ENSMUST00000067752
AA Change: Y38H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065271
Gene: ENSMUSG00000054619
AA Change: Y38H

DomainStartEndE-ValueType
Pfam:Ubie_methyltran 31 195 7.7e-12 PFAM
Pfam:Methyltransf_23 47 221 7e-20 PFAM
Pfam:Methyltransf_31 68 223 1.5e-15 PFAM
Pfam:Methyltransf_18 71 176 1e-9 PFAM
Pfam:Methyltransf_25 74 168 4e-12 PFAM
Pfam:Methyltransf_12 75 170 8.6e-16 PFAM
Pfam:Methyltransf_11 75 172 6.6e-23 PFAM
Pfam:Methyltransf_8 117 197 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229217
AA Change: Y20H

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000229574
Predicted Effect probably benign
Transcript: ENSMUST00000229588
AA Change: Y38H

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000230018
Predicted Effect probably benign
Transcript: ENSMUST00000230252
Predicted Effect probably benign
Transcript: ENSMUST00000230472
AA Change: Y20H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000231166
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Tshz1 T C 18: 84,015,231 T351A probably benign Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Mettl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02820:Mettl7a1 APN 15 100305052 nonsense probably null
R2258:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R2259:Mettl7a1 UTSW 15 100313168 missense probably benign 0.43
R4260:Mettl7a1 UTSW 15 100313070 missense probably benign 0.12
R4625:Mettl7a1 UTSW 15 100313058 missense probably damaging 1.00
R4932:Mettl7a1 UTSW 15 100305106 missense probably benign 0.26
R7802:Mettl7a1 UTSW 15 100305301 missense possibly damaging 0.80
R7839:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
R7922:Mettl7a1 UTSW 15 100305076 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGGCTGCAACCTTCCAAAGGGATG -3'
(R):5'- GGGATAGAACTTGAAGTTGGCTCCG -3'

Sequencing Primer
(F):5'- TTTGGTTcccccccccc -3'
(R):5'- TGCAGATTGCTGAAGAGCTC -3'
Posted On2013-11-08