Incidental Mutation 'R0943:Tshz1'
ID 81986
Institutional Source Beutler Lab
Gene Symbol Tshz1
Ensembl Gene ENSMUSG00000046982
Gene Name teashirt zinc finger family member 1
Synonyms Mtsh1, teashirt1, Sdccag33, D18Bwg1409e, Tsh1, NY-CO-33, 5730407I04Rik
MMRRC Submission 039082-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0943 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 84011627-84086404 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84015231 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 351 (T351A)
Ref Sequence ENSEMBL: ENSMUSP00000089388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060303]
AlphaFold Q5DTH5
Predicted Effect probably benign
Transcript: ENSMUST00000060303
AA Change: T351A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000089388
Gene: ENSMUSG00000046982
AA Change: T351A

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 153 195 N/A INTRINSIC
ZnF_C2H2 246 270 1.86e0 SMART
ZnF_C2H2 307 331 3.83e-2 SMART
ZnF_C2H2 416 440 5.34e0 SMART
low complexity region 497 515 N/A INTRINSIC
HOX 890 964 4.15e-4 SMART
ZnF_C2H2 976 998 4.34e-1 SMART
ZnF_C2H2 1044 1067 4.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175783
SMART Domains Protein: ENSMUSP00000135640
Gene: ENSMUSG00000046982

DomainStartEndE-ValueType
ZnF_C2H2 43 67 1.7e-4 SMART
ZnF_C2H2 152 176 2.3e-2 SMART
low complexity region 233 251 N/A INTRINSIC
HOX 626 700 2.1e-6 SMART
ZnF_C2H2 712 734 1.9e-3 SMART
ZnF_C2H2 780 803 1.8e-5 SMART
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele die shortly after birth of respiratory distress, have defects in soft palate formation, have altered axial skeleton and have middle ear defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C T 2: 85,488,765 D398N probably damaging Het
A230050P20Rik A T 9: 20,872,962 H160L possibly damaging Het
Agtpbp1 T C 13: 59,500,602 N468S probably benign Het
Card6 A G 15: 5,100,286 S543P probably damaging Het
Celsr1 T G 15: 85,903,288 T2750P probably damaging Het
Csmd3 A G 15: 47,675,739 M2341T probably damaging Het
Dym A G 18: 75,286,769 *670W probably null Het
Ehbp1 T C 11: 22,095,883 D597G probably benign Het
Emx1 G A 6: 85,203,919 W206* probably null Het
Esr1 A G 10: 4,746,781 K210R probably damaging Het
Extl1 TGCGTTGCACCGATACCGGG TG 4: 134,357,677 probably benign Het
Fam72a T C 1: 131,528,779 S27P possibly damaging Het
Fanca A T 8: 123,274,186 C1152S probably damaging Het
Fras1 G A 5: 96,726,543 V2276I probably benign Het
Gm9008 T C 6: 76,496,415 H406R probably benign Het
Hoxb13 A G 11: 96,195,973 E202G probably benign Het
Lcmt1 T G 7: 123,401,439 probably null Het
Mettl7a1 T C 15: 100,304,958 Y20H probably benign Het
Nars2 C T 7: 96,955,931 probably benign Het
Neil3 ATATTTATTTATTTATTTATTTATTTATTTATT ATATTTATTTATTTATTTATTTATTTATTTATTTATT 8: 53,609,369 probably benign Het
Nup153 T C 13: 46,696,772 probably benign Het
Olfr1257 T C 2: 89,880,961 V45A probably benign Het
Olfr1466 C A 19: 13,341,793 H12N probably benign Het
Prkar2a T C 9: 108,733,276 probably benign Het
Ptprc T C 1: 138,111,164 T209A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rprd2 C T 3: 95,784,247 V239I possibly damaging Het
Sgo2b A G 8: 63,931,335 F209S possibly damaging Het
Spry2 T C 14: 105,893,587 Y55C probably damaging Het
Tbc1d32 A T 10: 56,161,147 V667E probably benign Het
Tbrg4 A G 11: 6,619,008 F388L probably damaging Het
Usp48 A G 4: 137,644,470 N969S possibly damaging Het
Vmn2r108 A T 17: 20,471,135 C375* probably null Het
Vps45 T A 3: 96,057,024 I62F probably benign Het
Xab2 A G 8: 3,613,667 F388L probably benign Het
Zfp735 A G 11: 73,712,083 T618A probably benign Het
Zswim2 T A 2: 83,917,998 R279S possibly damaging Het
Other mutations in Tshz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:Tshz1 APN 18 84013509 missense possibly damaging 0.94
IGL02934:Tshz1 APN 18 84013090 missense probably damaging 1.00
ANU18:Tshz1 UTSW 18 84014661 missense probably damaging 1.00
PIT4810001:Tshz1 UTSW 18 84013250 missense possibly damaging 0.85
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0052:Tshz1 UTSW 18 84014945 missense possibly damaging 0.76
R0364:Tshz1 UTSW 18 84016124 missense probably benign 0.31
R0391:Tshz1 UTSW 18 84016049 missense possibly damaging 0.93
R0515:Tshz1 UTSW 18 84015965 missense probably benign
R0942:Tshz1 UTSW 18 84013053 missense probably damaging 0.99
R1472:Tshz1 UTSW 18 84013805 missense possibly damaging 0.93
R1895:Tshz1 UTSW 18 84013433 missense probably damaging 1.00
R2022:Tshz1 UTSW 18 84013862 missense probably damaging 0.98
R2860:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R2861:Tshz1 UTSW 18 84014980 missense probably damaging 1.00
R4027:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4028:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4030:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4031:Tshz1 UTSW 18 84014829 missense possibly damaging 0.74
R4119:Tshz1 UTSW 18 84014189 missense probably benign 0.00
R4233:Tshz1 UTSW 18 84016195 missense probably benign 0.00
R4573:Tshz1 UTSW 18 84015082 missense probably damaging 1.00
R4604:Tshz1 UTSW 18 84013374 missense probably damaging 1.00
R4960:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R5085:Tshz1 UTSW 18 84013928 missense probably benign 0.01
R5124:Tshz1 UTSW 18 84015467 missense probably damaging 1.00
R5150:Tshz1 UTSW 18 84013215 nonsense probably null
R5357:Tshz1 UTSW 18 84015080 missense probably damaging 1.00
R5530:Tshz1 UTSW 18 84013268 missense probably damaging 1.00
R5718:Tshz1 UTSW 18 84014524 missense probably damaging 1.00
R5750:Tshz1 UTSW 18 84013961 missense possibly damaging 0.93
R5778:Tshz1 UTSW 18 84015680 missense probably damaging 1.00
R6052:Tshz1 UTSW 18 84014069 missense probably damaging 1.00
R6279:Tshz1 UTSW 18 84015311 missense probably damaging 1.00
R6393:Tshz1 UTSW 18 84013220 missense probably damaging 1.00
R6407:Tshz1 UTSW 18 84015966 missense possibly damaging 0.55
R6425:Tshz1 UTSW 18 84015563 missense probably damaging 0.99
R6998:Tshz1 UTSW 18 84015841 missense probably benign 0.00
R7165:Tshz1 UTSW 18 84015927 missense probably damaging 1.00
R7233:Tshz1 UTSW 18 84014819 missense possibly damaging 0.63
R7330:Tshz1 UTSW 18 84014831 missense probably damaging 0.96
R7491:Tshz1 UTSW 18 84015641 missense probably damaging 1.00
R7579:Tshz1 UTSW 18 84014665 nonsense probably null
R7592:Tshz1 UTSW 18 84014048 missense probably damaging 1.00
R7659:Tshz1 UTSW 18 84016075 missense probably damaging 0.97
R7702:Tshz1 UTSW 18 84014336 missense probably damaging 1.00
R7844:Tshz1 UTSW 18 84014171 missense probably benign 0.00
R7908:Tshz1 UTSW 18 84014607 nonsense probably null
R7941:Tshz1 UTSW 18 84015392 missense possibly damaging 0.91
R7947:Tshz1 UTSW 18 84015657 missense probably damaging 1.00
R8435:Tshz1 UTSW 18 84014024 missense probably damaging 1.00
R8750:Tshz1 UTSW 18 84015037 missense probably damaging 1.00
R8774:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R8774-TAIL:Tshz1 UTSW 18 84014976 missense possibly damaging 0.96
R9029:Tshz1 UTSW 18 84013514 missense probably damaging 0.98
R9031:Tshz1 UTSW 18 84014862 missense probably benign 0.08
R9573:Tshz1 UTSW 18 84014279 missense probably benign 0.45
R9584:Tshz1 UTSW 18 84014964 missense probably damaging 1.00
R9596:Tshz1 UTSW 18 84013779 missense possibly damaging 0.92
R9701:Tshz1 UTSW 18 84014454 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTAGCACCATTCTGGTAGCCGTAAC -3'
(R):5'- GACAGGCCACTATCGAGATGACAAC -3'

Sequencing Primer
(F):5'- ACGGTTGTTCGGAGTCAC -3'
(R):5'- AGGAAGCGTTCCCTGATGG -3'
Posted On 2013-11-08