Incidental Mutation 'R0944:Zc3h6'
ID 81992
Institutional Source Beutler Lab
Gene Symbol Zc3h6
Ensembl Gene ENSMUSG00000042851
Gene Name zinc finger CCCH type containing 6
Synonyms 4631426G04Rik, 4833425H18Rik
MMRRC Submission 039083-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R0944 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 128809322-128860483 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128848736 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 321 (Y321C)
Ref Sequence ENSEMBL: ENSMUSP00000105949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110320]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110320
AA Change: Y321C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: Y321C

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
coiled coil region 30 71 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
ZnF_C3H1 271 296 1.72e-4 SMART
ZnF_C3H1 300 325 2.51e-6 SMART
ZnF_C3H1 326 349 5.24e0 SMART
coiled coil region 351 383 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 493 509 N/A INTRINSIC
low complexity region 698 707 N/A INTRINSIC
low complexity region 784 798 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
Meta Mutation Damage Score 0.8897 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,455,268 (GRCm39) R118K unknown Het
Abcc6 T A 7: 45,664,929 (GRCm39) I301F possibly damaging Het
Akap9 C A 5: 4,114,742 (GRCm39) probably null Het
Alg6 A G 4: 99,650,297 (GRCm39) I506V probably benign Het
B3gat1 C T 9: 26,668,237 (GRCm39) R276C probably damaging Het
Camk1 A G 6: 113,315,352 (GRCm39) Y105H probably damaging Het
Ccdc81 T C 7: 89,515,777 (GRCm39) N634S probably damaging Het
Clcn1 C A 6: 42,290,075 (GRCm39) Q837K probably benign Het
Clec16a A G 16: 10,506,510 (GRCm39) probably benign Het
Col22a1 T C 15: 71,753,511 (GRCm39) I130V probably benign Het
Coro2b T C 9: 62,335,263 (GRCm39) S308G probably benign Het
Cpxm1 A G 2: 130,239,423 (GRCm39) W2R probably damaging Het
Csmd3 T C 15: 47,475,227 (GRCm39) N3364S probably damaging Het
Dgkq A G 5: 108,804,331 (GRCm39) V131A probably damaging Het
Dnai1 A G 4: 41,629,997 (GRCm39) S469G probably benign Het
Efcab3 T G 11: 104,601,556 (GRCm39) probably null Het
Eml4 G A 17: 83,785,489 (GRCm39) E885K probably benign Het
Etfa A T 9: 55,396,122 (GRCm39) I148N probably damaging Het
Gpbar1 A G 1: 74,318,681 (GRCm39) D308G probably benign Het
Gprin3 T C 6: 59,330,900 (GRCm39) E469G possibly damaging Het
Igkv1-115 T C 6: 68,138,667 (GRCm39) V90A probably damaging Het
Ints2 A G 11: 86,135,289 (GRCm39) V375A possibly damaging Het
Mindy3 T C 2: 12,400,993 (GRCm39) M242V possibly damaging Het
Or11m3 A G 15: 98,395,565 (GRCm39) I71V probably benign Het
Or1n1b T C 2: 36,780,698 (GRCm39) H54R probably damaging Het
Or5t9 A C 2: 86,659,281 (GRCm39) I62L probably benign Het
P3h1 G A 4: 119,095,956 (GRCm39) E355K probably benign Het
Paxbp1 T C 16: 90,820,315 (GRCm39) T703A probably benign Het
Pcdh15 A T 10: 74,046,302 (GRCm39) Y193F probably damaging Het
Pdxdc1 A G 16: 13,656,233 (GRCm39) V613A probably damaging Het
Plekha5 T C 6: 140,515,922 (GRCm39) probably benign Het
Pmel A T 10: 128,551,126 (GRCm39) Q123L possibly damaging Het
Prl6a1 T C 13: 27,502,149 (GRCm39) probably benign Het
Rcan1 T C 16: 92,190,379 (GRCm39) T187A probably damaging Het
Rp1l1 A G 14: 64,269,681 (GRCm39) S1756G probably benign Het
Runx2 A T 17: 44,919,123 (GRCm39) M405K probably damaging Het
Serinc5 T C 13: 92,797,613 (GRCm39) Y39H probably damaging Het
Sgsm1 G A 5: 113,413,740 (GRCm39) T676I probably benign Het
Slc6a15 G C 10: 103,245,657 (GRCm39) V547L probably benign Het
Slk T C 19: 47,597,432 (GRCm39) I80T probably damaging Het
Spice1 A G 16: 44,205,124 (GRCm39) N810S probably benign Het
Spred2 A G 11: 19,951,104 (GRCm39) probably benign Het
Tbc1d4 C G 14: 101,716,656 (GRCm39) probably benign Het
Tdrd7 G A 4: 46,029,762 (GRCm39) V1032M probably benign Het
Tlr11 A G 14: 50,599,793 (GRCm39) N593S probably benign Het
Trpa1 T C 1: 14,982,585 (GRCm39) probably null Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Usp25 T C 16: 76,878,335 (GRCm39) probably benign Het
Vmn2r97 T A 17: 19,167,665 (GRCm39) S640T probably benign Het
Zfp329 T A 7: 12,545,395 (GRCm39) N43I probably benign Het
Other mutations in Zc3h6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Zc3h6 APN 2 128,853,795 (GRCm39) missense probably damaging 1.00
IGL01880:Zc3h6 APN 2 128,859,298 (GRCm39) missense probably damaging 0.99
IGL02160:Zc3h6 APN 2 128,839,605 (GRCm39) missense probably benign 0.02
IGL02161:Zc3h6 APN 2 128,835,146 (GRCm39) missense possibly damaging 0.90
IGL02202:Zc3h6 APN 2 128,858,501 (GRCm39) missense probably damaging 1.00
IGL02547:Zc3h6 APN 2 128,857,531 (GRCm39) missense probably benign 0.00
IGL02973:Zc3h6 APN 2 128,839,715 (GRCm39) missense probably damaging 0.98
BB001:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
BB011:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R0336:Zc3h6 UTSW 2 128,857,332 (GRCm39) missense possibly damaging 0.81
R0420:Zc3h6 UTSW 2 128,856,747 (GRCm39) missense probably benign 0.00
R0538:Zc3h6 UTSW 2 128,859,143 (GRCm39) missense possibly damaging 0.75
R1151:Zc3h6 UTSW 2 128,859,056 (GRCm39) missense probably benign 0.00
R1528:Zc3h6 UTSW 2 128,858,989 (GRCm39) missense probably benign 0.01
R1698:Zc3h6 UTSW 2 128,859,278 (GRCm39) missense probably benign
R1712:Zc3h6 UTSW 2 128,858,654 (GRCm39) missense probably damaging 1.00
R1913:Zc3h6 UTSW 2 128,858,540 (GRCm39) missense probably damaging 1.00
R1926:Zc3h6 UTSW 2 128,839,715 (GRCm39) missense probably damaging 0.98
R2030:Zc3h6 UTSW 2 128,848,006 (GRCm39) missense probably damaging 1.00
R2051:Zc3h6 UTSW 2 128,857,538 (GRCm39) missense possibly damaging 0.55
R2133:Zc3h6 UTSW 2 128,809,750 (GRCm39) missense possibly damaging 0.53
R2273:Zc3h6 UTSW 2 128,856,629 (GRCm39) missense probably benign 0.01
R2328:Zc3h6 UTSW 2 128,835,122 (GRCm39) missense possibly damaging 0.85
R2862:Zc3h6 UTSW 2 128,857,380 (GRCm39) missense probably benign 0.43
R2899:Zc3h6 UTSW 2 128,844,152 (GRCm39) missense probably benign 0.00
R3711:Zc3h6 UTSW 2 128,859,251 (GRCm39) missense probably benign 0.00
R3743:Zc3h6 UTSW 2 128,839,712 (GRCm39) missense probably damaging 1.00
R3893:Zc3h6 UTSW 2 128,858,060 (GRCm39) missense probably damaging 1.00
R4748:Zc3h6 UTSW 2 128,844,160 (GRCm39) missense probably damaging 1.00
R5025:Zc3h6 UTSW 2 128,852,353 (GRCm39) missense possibly damaging 0.87
R5026:Zc3h6 UTSW 2 128,859,229 (GRCm39) missense probably benign 0.00
R5125:Zc3h6 UTSW 2 128,856,399 (GRCm39) missense possibly damaging 0.93
R5373:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5374:Zc3h6 UTSW 2 128,844,076 (GRCm39) missense possibly damaging 0.75
R5703:Zc3h6 UTSW 2 128,835,372 (GRCm39) intron probably benign
R5802:Zc3h6 UTSW 2 128,857,479 (GRCm39) missense possibly damaging 0.56
R5876:Zc3h6 UTSW 2 128,835,197 (GRCm39) missense probably benign 0.29
R5879:Zc3h6 UTSW 2 128,839,696 (GRCm39) splice site probably null
R5950:Zc3h6 UTSW 2 128,839,710 (GRCm39) nonsense probably null
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6031:Zc3h6 UTSW 2 128,809,732 (GRCm39) missense possibly damaging 0.85
R6781:Zc3h6 UTSW 2 128,857,341 (GRCm39) missense probably damaging 0.99
R7323:Zc3h6 UTSW 2 128,835,331 (GRCm39) missense unknown
R7340:Zc3h6 UTSW 2 128,835,110 (GRCm39) missense possibly damaging 0.90
R7572:Zc3h6 UTSW 2 128,859,172 (GRCm39) missense probably benign 0.02
R7576:Zc3h6 UTSW 2 128,856,473 (GRCm39) missense probably damaging 1.00
R7797:Zc3h6 UTSW 2 128,857,555 (GRCm39) critical splice donor site probably null
R7924:Zc3h6 UTSW 2 128,857,400 (GRCm39) missense possibly damaging 0.52
R8048:Zc3h6 UTSW 2 128,858,934 (GRCm39) missense probably benign 0.30
R8877:Zc3h6 UTSW 2 128,856,319 (GRCm39) nonsense probably null
R9076:Zc3h6 UTSW 2 128,859,096 (GRCm39) nonsense probably null
R9577:Zc3h6 UTSW 2 128,858,102 (GRCm39) missense
R9687:Zc3h6 UTSW 2 128,859,281 (GRCm39) missense probably damaging 1.00
R9745:Zc3h6 UTSW 2 128,859,155 (GRCm39) missense probably benign 0.08
Z1176:Zc3h6 UTSW 2 128,858,141 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGGCCTACTAATGAGTTGTTGC -3'
(R):5'- GGGCACTTTGCCCATTTTAAGCAC -3'

Sequencing Primer
(F):5'- TGTGCGTAGCTCAGTATCTAAC -3'
(R):5'- TTGCCCATTTTAAGCACAGAGAC -3'
Posted On 2013-11-08