Incidental Mutation 'R0944:Cpxm1'
ID81993
Institutional Source Beutler Lab
Gene Symbol Cpxm1
Ensembl Gene ENSMUSG00000027408
Gene Namecarboxypeptidase X 1 (M14 family)
SynonymsCpx-1
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R0944 (G1)
Quality Score109
Status Validated
Chromosome2
Chromosomal Location130390775-130397574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130397503 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000028897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028897]
Predicted Effect probably damaging
Transcript: ENSMUST00000028897
AA Change: W2R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028897
Gene: ENSMUSG00000027408
AA Change: W2R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
FA58C 104 263 1.44e-28 SMART
Zn_pept 410 699 5.77e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130533
Meta Mutation Damage Score 0.0917 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a member of the carboxypeptidase family of proteins. Cloning of a comparable locus in mouse indicates that the encoded protein contains a discoidin domain and a carboxypeptidase domain, but the protein appears to lack residues necessary for carboxypeptidase activity.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Cpxm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Cpxm1 APN 2 130395943 missense probably damaging 1.00
IGL01327:Cpxm1 APN 2 130396357 missense probably benign 0.00
IGL01373:Cpxm1 APN 2 130394135 missense probably damaging 1.00
IGL01622:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01623:Cpxm1 APN 2 130391271 missense probably benign 0.00
IGL01981:Cpxm1 APN 2 130394140 nonsense probably null
IGL02031:Cpxm1 APN 2 130393681 missense probably damaging 1.00
IGL02369:Cpxm1 APN 2 130396424 missense probably damaging 1.00
IGL03057:Cpxm1 APN 2 130393189 missense probably damaging 1.00
R0316:Cpxm1 UTSW 2 130393171 missense probably damaging 1.00
R0544:Cpxm1 UTSW 2 130393135 missense probably damaging 1.00
R0726:Cpxm1 UTSW 2 130390939 missense probably damaging 0.96
R1334:Cpxm1 UTSW 2 130393563 missense probably damaging 0.99
R1366:Cpxm1 UTSW 2 130396122 missense probably damaging 1.00
R1429:Cpxm1 UTSW 2 130396444 missense probably damaging 0.98
R1654:Cpxm1 UTSW 2 130393546 missense possibly damaging 0.51
R1824:Cpxm1 UTSW 2 130395697 missense probably damaging 0.99
R2144:Cpxm1 UTSW 2 130397410 missense probably benign 0.00
R2200:Cpxm1 UTSW 2 130393197 missense probably damaging 1.00
R2320:Cpxm1 UTSW 2 130394211 missense probably damaging 1.00
R2434:Cpxm1 UTSW 2 130394084 missense probably damaging 1.00
R3118:Cpxm1 UTSW 2 130393573 missense possibly damaging 0.80
R4601:Cpxm1 UTSW 2 130393576 missense possibly damaging 0.83
R5020:Cpxm1 UTSW 2 130395977 splice site probably null
R5041:Cpxm1 UTSW 2 130394070 missense probably damaging 1.00
R5727:Cpxm1 UTSW 2 130390963 nonsense probably null
R5806:Cpxm1 UTSW 2 130397473 missense probably damaging 1.00
R6660:Cpxm1 UTSW 2 130396149 missense probably damaging 1.00
R7431:Cpxm1 UTSW 2 130394046 missense probably benign 0.00
R7491:Cpxm1 UTSW 2 130393567 missense probably benign 0.22
R7743:Cpxm1 UTSW 2 130393422 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTCACCATTTGCCTTTGTGGACG -3'
(R):5'- AATGTGCGGTGACTTTGCAGCC -3'

Sequencing Primer
(F):5'- AACGCTGCTGTGTGGAG -3'
(R):5'- GTCTCTGGACCCCAgcc -3'
Posted On2013-11-08