Mutagenetix > Incidental Mutations

Incidental Mutation 'R0944:Clcn1'

82002

Institutional Source

Beutler Lab

Gene Symbol

Clcn1

Ensembl Gene

ENSMUSG00000029862

Gene Name

chloride channel, voltage-sensitive 1

Synonyms

Clc1, SMCC1, nmf355, NMF355, Clc-1

MMRRC Submission

039083-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42286685-42315756 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 42313141 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 837 (Q837K)

Ref Sequence

ENSEMBL: ENSMUSP00000031894 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]

Predicted Effect

probably benign
Transcript: ENSMUST00000031891

SMART Domains

Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	49	341	7.4e-128	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000031894
AA Change: Q837K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: Q837K

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	572	3.2e-87	PFAM
Blast:CBS	612	662	1e-24	BLAST
low complexity region	723	747	N/A	INTRINSIC
Blast:CBS	830	877	4e-19	BLAST
low complexity region	928	950	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095974

SMART Domains

Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	33	325	4.5e-128	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114684

SMART Domains

Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
Pfam:Voltage_CLC	3	254	2.6e-42	PFAM
CBS	294	344	1.3e1	SMART
low complexity region	405	429	N/A	INTRINSIC
Blast:CBS	480	524	2e-13	BLAST
low complexity region	575	597	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143278

SMART Domains

Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

Domain	Start	End	E-Value	Type
Pfam:FAM131	61	353	1.9e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163235

SMART Domains

Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	12	36	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000163936
AA Change: Q765K

SMART Domains

Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: Q765K

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	1.2e-27	PFAM
Pfam:Voltage_CLC	258	501	3.9e-44	PFAM
PDB:2D4Z\|B	520	807	2e-47	PDB
Blast:CBS	541	591	2e-24	BLAST
Blast:CBS	759	806	3e-19	BLAST
low complexity region	857	879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164091

SMART Domains

Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	121	130	N/A	INTRINSIC
Pfam:Voltage_CLC	170	256	2.9e-20	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165780

SMART Domains

Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	227	9.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168660

SMART Domains

Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	88	97	N/A	INTRINSIC
Pfam:Voltage_CLC	136	257	1.1e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169024

SMART Domains

Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	261	2.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169902

Predicted Effect

probably benign
Transcript: ENSMUST00000170028

SMART Domains

Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

Domain	Start	End	E-Value	Type
low complexity region	92	101	N/A	INTRINSIC
Pfam:Voltage_CLC	141	235	8e-22	PFAM

Meta Mutation Damage Score

0.0770

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110018I06Rik	G	A	12: 107,489,009	R118K	unknown	Het
Abcc6	T	A	7: 46,015,505	I301F	possibly damaging	Het
Akap9	C	A	5: 4,064,742		probably null	Het
Alg6	A	G	4: 99,762,060	I506V	probably benign	Het
B3gat1	C	T	9: 26,756,941	R276C	probably damaging	Het
Camk1	A	G	6: 113,338,391	Y105H	probably damaging	Het
Ccdc81	T	C	7: 89,866,569	N634S	probably damaging	Het
Clec16a	A	G	16: 10,688,646		probably benign	Het
Col22a1	T	C	15: 71,881,662	I130V	probably benign	Het
Coro2b	T	C	9: 62,427,981	S308G	probably benign	Het
Cpxm1	A	G	2: 130,397,503	W2R	probably damaging	Het
Csmd3	T	C	15: 47,611,831	N3364S	probably damaging	Het
Dgkq	A	G	5: 108,656,465	V131A	probably damaging	Het
Dnaic1	A	G	4: 41,629,997	S469G	probably benign	Het
Eml4	G	A	17: 83,478,060	E885K	probably benign	Het
Etfa	A	T	9: 55,488,838	I148N	probably damaging	Het
Gm11639	T	G	11: 104,710,730		probably null	Het
Gpbar1	A	G	1: 74,279,522	D308G	probably benign	Het
Gprin3	T	C	6: 59,353,915	E469G	possibly damaging	Het
Igkv1-115	T	C	6: 68,161,683	V90A	probably damaging	Het
Ints2	A	G	11: 86,244,463	V375A	possibly damaging	Het
Mindy3	T	C	2: 12,396,182	M242V	possibly damaging	Het
Olfr1094	A	C	2: 86,828,937	I62L	probably benign	Het
Olfr279	A	G	15: 98,497,684	I71V	probably benign	Het
Olfr353	T	C	2: 36,890,686	H54R	probably damaging	Het
P3h1	G	A	4: 119,238,759	E355K	probably benign	Het
Paxbp1	T	C	16: 91,023,427	T703A	probably benign	Het
Pcdh15	A	T	10: 74,210,470	Y193F	probably damaging	Het
Pdxdc1	A	G	16: 13,838,369	V613A	probably damaging	Het
Plekha5	T	C	6: 140,570,196		probably benign	Het
Pmel	A	T	10: 128,715,257	Q123L	possibly damaging	Het
Prl6a1	T	C	13: 27,318,166		probably benign	Het
Rcan1	T	C	16: 92,393,491	T187A	probably damaging	Het
Rp1l1	A	G	14: 64,032,232	S1756G	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc5	T	C	13: 92,661,105	Y39H	probably damaging	Het
Sgsm1	G	A	5: 113,265,874	T676I	probably benign	Het
Slc6a15	G	C	10: 103,409,796	V547L	probably benign	Het
Slk	T	C	19: 47,608,993	I80T	probably damaging	Het
Spice1	A	G	16: 44,384,761	N810S	probably benign	Het
Spred2	A	G	11: 20,001,104		probably benign	Het
Tbc1d4	C	G	14: 101,479,220		probably benign	Het
Tdrd7	G	A	4: 46,029,762	V1032M	probably benign	Het
Tlr11	A	G	14: 50,362,336	N593S	probably benign	Het
Trpa1	T	C	1: 14,912,361		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp25	T	C	16: 77,081,447		probably benign	Het
Vmn2r97	T	A	17: 18,947,403	S640T	probably benign	Het
Zc3h6	A	G	2: 129,006,816	Y321C	probably damaging	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Clcn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Clcn1	APN	6	42291703	missense	probably damaging	1.00
IGL01732:Clcn1	APN	6	42310672	splice site	probably benign
IGL02055:Clcn1	APN	6	42307555	missense	probably damaging	1.00
IGL02507:Clcn1	APN	6	42307073	splice site	probably benign
IGL02649:Clcn1	APN	6	42298829	missense	probably damaging	1.00
IGL02739:Clcn1	APN	6	42286780	unclassified	probably null
IGL03148:Clcn1	APN	6	42299991	critical splice donor site	probably null
IGL03190:Clcn1	APN	6	42290103	missense	probably benign	0.02
IGL03327:Clcn1	APN	6	42311219	missense	probably benign	0.00
IGL03346:Clcn1	APN	6	42311219	missense	probably benign	0.00
maimed	UTSW	6	42298820	missense	probably damaging	1.00
R0167:Clcn1	UTSW	6	42286836	missense	probably damaging	1.00
R0323:Clcn1	UTSW	6	42310140	missense	probably damaging	0.99
R0491:Clcn1	UTSW	6	42310581	missense	probably benign
R0573:Clcn1	UTSW	6	42313045	splice site	probably null
R0615:Clcn1	UTSW	6	42305575	missense	probably damaging	1.00
R1562:Clcn1	UTSW	6	42300235	missense	probably benign	0.29
R1566:Clcn1	UTSW	6	42291440	missense	possibly damaging	0.58
R1692:Clcn1	UTSW	6	42313098	missense	possibly damaging	0.67
R1728:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1729:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1772:Clcn1	UTSW	6	42294145	missense	probably damaging	1.00
R1784:Clcn1	UTSW	6	42299514	missense	possibly damaging	0.86
R1793:Clcn1	UTSW	6	42298926	critical splice donor site	probably null
R1861:Clcn1	UTSW	6	42313991	missense	possibly damaging	0.63
R1864:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R1865:Clcn1	UTSW	6	42305541	missense	probably damaging	1.00
R2356:Clcn1	UTSW	6	42291625	missense	probably damaging	1.00
R2403:Clcn1	UTSW	6	42313112	missense	probably damaging	0.99
R2987:Clcn1	UTSW	6	42298850	missense	probably damaging	1.00
R3082:Clcn1	UTSW	6	42290178	missense	probably damaging	0.98
R3500:Clcn1	UTSW	6	42292995	missense	probably damaging	0.99
R3747:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R3748:Clcn1	UTSW	6	42299915	missense	probably damaging	1.00
R4041:Clcn1	UTSW	6	42309968	missense	probably damaging	1.00
R4749:Clcn1	UTSW	6	42290197	splice site	probably null
R4836:Clcn1	UTSW	6	42309964	missense	probably damaging	0.96
R5021:Clcn1	UTSW	6	42310988	nonsense	probably null
R5085:Clcn1	UTSW	6	42313880	missense	probably benign	0.41
R5528:Clcn1	UTSW	6	42300341	missense	probably benign	0.01
R5628:Clcn1	UTSW	6	42298889	missense	probably damaging	0.96
R5678:Clcn1	UTSW	6	42307265	missense	probably damaging	1.00
R5943:Clcn1	UTSW	6	42292966	missense	probably damaging	1.00
R6053:Clcn1	UTSW	6	42300274	nonsense	probably null
R6175:Clcn1	UTSW	6	42314162	missense	probably damaging	1.00
R6394:Clcn1	UTSW	6	42307590	missense	possibly damaging	0.84
R6394:Clcn1	UTSW	6	42313238	missense	possibly damaging	0.82
R7012:Clcn1	UTSW	6	42290608	missense	probably benign	0.01
R7020:Clcn1	UTSW	6	42298820	missense	probably damaging	1.00
R7048:Clcn1	UTSW	6	42307543	missense	probably damaging	1.00
R7212:Clcn1	UTSW	6	42291389	missense	possibly damaging	0.46
R7225:Clcn1	UTSW	6	42293462	missense	probably damaging	1.00
R7264:Clcn1	UTSW	6	42298838	missense	probably damaging	1.00
R7636:Clcn1	UTSW	6	42291334	nonsense	probably null
R7663:Clcn1	UTSW	6	42310063	missense	possibly damaging	0.79
Z1088:Clcn1	UTSW	6	42300360	missense	probably benign	0.40
Z1088:Clcn1	UTSW	6	42307256	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGAGAACTCAGCAGACTACAG -3'
(R):5'- ACCTCTTCTAGTGCCAAGACACCTC -3'

Sequencing Primer
(F):5'- TCTGCGTACCTGAAGGTGAAG -3'
(R):5'- AGACACCTCTGAGCTTCCC -3'

Posted On

2013-11-08