Incidental Mutation 'R0944:Gprin3'
ID82003
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59353915 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 469 (E469G)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051065
AA Change: E469G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: E469G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59354464 missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3893:Gprin3 UTSW 6 59354479 missense probably benign 0.12
R3983:Gprin3 UTSW 6 59354560 missense possibly damaging 0.72
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59354713 missense probably benign
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59353331 nonsense probably null
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59354032 missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59353711 missense probably benign 0.22
R7974:Gprin3 UTSW 6 59353711 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CTTTCACGATAAGAGGAGACGCAGG -3'
(R):5'- ACAGGTGCATATCCAAGCAGCC -3'

Sequencing Primer
(F):5'- AGACGCAGGCTTCTTGTCC -3'
(R):5'- TCCTGCGGCTTTCAAAGG -3'
Posted On2013-11-08