Incidental Mutation 'R0944:Camk1'
ID82005
Institutional Source Beutler Lab
Gene Symbol Camk1
Ensembl Gene ENSMUSG00000030272
Gene Namecalcium/calmodulin-dependent protein kinase I
SynonymsD6Ertd263e, CaMKIalpha
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113334124-113343984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113338391 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 105 (Y105H)
Ref Sequence ENSEMBL: ENSMUSP00000117749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032406] [ENSMUST00000032409] [ENSMUST00000136263] [ENSMUST00000155543] [ENSMUST00000204834]
Predicted Effect probably benign
Transcript: ENSMUST00000032406
SMART Domains Protein: ENSMUSP00000032406
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 141 4e-38 PFAM
ENDO3c 146 316 4.84e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000032409
AA Change: Y149H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032409
Gene: ENSMUSG00000030272
AA Change: Y149H

DomainStartEndE-ValueType
S_TKc 20 276 5.03e-111 SMART
low complexity region 319 336 N/A INTRINSIC
low complexity region 358 370 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136263
SMART Domains Protein: ENSMUSP00000144792
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 130 3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147945
SMART Domains Protein: ENSMUSP00000116265
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Blast:ENDO3c 7 75 7e-46 BLAST
PDB:1KO9|A 7 104 1e-55 PDB
SCOP:d1ko9a1 8 82 1e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153067
Predicted Effect probably damaging
Transcript: ENSMUST00000155543
AA Change: Y105H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117749
Gene: ENSMUSG00000030272
AA Change: Y105H

DomainStartEndE-ValueType
Pfam:Pkinase 8 162 1.4e-45 PFAM
Pfam:Pkinase_Tyr 9 162 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156853
Predicted Effect probably benign
Transcript: ENSMUST00000204834
SMART Domains Protein: ENSMUSP00000144905
Gene: ENSMUSG00000030271

DomainStartEndE-ValueType
Pfam:OGG_N 25 134 1.2e-27 PFAM
Meta Mutation Damage Score 0.8082 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium/calmodulin-dependent protein kinase I is expressed in many tissues and is a component of a calmodulin-dependent protein kinase cascade. Calcium/calmodulin directly activates calcium/calmodulin-dependent protein kinase I by binding to the enzyme and indirectly promotes the phosphorylation and synergistic activation of the enzyme by calcium/calmodulin-dependent protein kinase I kinase. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Camk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Camk1 APN 6 113336211 missense probably benign 0.00
IGL01063:Camk1 APN 6 113338372 missense probably damaging 0.98
R0415:Camk1 UTSW 6 113341891 nonsense probably null
R2342:Camk1 UTSW 6 113341981 splice site probably benign
R5646:Camk1 UTSW 6 113339340 missense probably damaging 0.99
R6734:Camk1 UTSW 6 113334384 missense probably benign 0.00
R6749:Camk1 UTSW 6 113334525 missense probably benign 0.02
R7015:Camk1 UTSW 6 113341926 missense probably benign
R7041:Camk1 UTSW 6 113339514 missense probably benign 0.03
R7355:Camk1 UTSW 6 113338346 missense probably damaging 1.00
R7575:Camk1 UTSW 6 113338364 missense probably damaging 1.00
R7686:Camk1 UTSW 6 113336197 missense probably damaging 1.00
R7748:Camk1 UTSW 6 113340328 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCACATGGTGATGACCTGTGTC -3'
(R):5'- TGTGGTAGGGTTGAAATCAGCCAAG -3'

Sequencing Primer
(F):5'- GGTGATGACCTGTGTCTACCC -3'
(R):5'- GTTCTATGAAAATCCTTCCTACAACC -3'
Posted On2013-11-08