Incidental Mutation 'R0944:Zfp329'
ID82007
Institutional Source Beutler Lab
Gene Symbol Zfp329
Ensembl Gene ENSMUSG00000057894
Gene Namezinc finger protein 329
Synonyms
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12804977-12818858 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12811468 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 43 (N43I)
Ref Sequence ENSEMBL: ENSMUSP00000113355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072222] [ENSMUST00000108546] [ENSMUST00000121215]
Predicted Effect probably benign
Transcript: ENSMUST00000072222
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072079
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108546
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104186
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121215
AA Change: N43I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113355
Gene: ENSMUSG00000057894
AA Change: N43I

DomainStartEndE-ValueType
low complexity region 147 160 N/A INTRINSIC
ZnF_C2H2 184 206 9.58e-3 SMART
ZnF_C2H2 212 234 1.12e-3 SMART
ZnF_C2H2 240 262 1.22e-4 SMART
ZnF_C2H2 268 290 1.95e-3 SMART
ZnF_C2H2 296 318 2.61e-4 SMART
ZnF_C2H2 324 346 5.14e-3 SMART
ZnF_C2H2 352 374 2.24e-3 SMART
ZnF_C2H2 380 402 5.21e-4 SMART
ZnF_C2H2 408 430 1.92e-2 SMART
ZnF_C2H2 436 458 5.21e-4 SMART
ZnF_C2H2 464 486 3.16e-3 SMART
ZnF_C2H2 492 514 2.2e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129647
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Other mutations in Zfp329
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Zfp329 APN 7 12811179 missense possibly damaging 0.87
IGL02830:Zfp329 APN 7 12810116 missense probably damaging 1.00
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0069:Zfp329 UTSW 7 12810932 missense probably damaging 0.98
R0122:Zfp329 UTSW 7 12810987 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0238:Zfp329 UTSW 7 12810829 missense probably damaging 1.00
R0539:Zfp329 UTSW 7 12806593 critical splice acceptor site probably null
R0570:Zfp329 UTSW 7 12810452 missense probably damaging 1.00
R0682:Zfp329 UTSW 7 12810284 missense probably damaging 1.00
R0811:Zfp329 UTSW 7 12811468 missense probably benign
R0812:Zfp329 UTSW 7 12811468 missense probably benign
R0945:Zfp329 UTSW 7 12811468 missense probably benign
R0946:Zfp329 UTSW 7 12811468 missense probably benign
R0948:Zfp329 UTSW 7 12811468 missense probably benign
R1632:Zfp329 UTSW 7 12810949 missense possibly damaging 0.63
R1980:Zfp329 UTSW 7 12811468 missense probably benign
R2172:Zfp329 UTSW 7 12810767 missense probably damaging 1.00
R2897:Zfp329 UTSW 7 12810486 missense probably damaging 1.00
R4256:Zfp329 UTSW 7 12807913 missense probably benign 0.03
R4383:Zfp329 UTSW 7 12811657 start gained probably benign
R4384:Zfp329 UTSW 7 12811657 start gained probably benign
R4692:Zfp329 UTSW 7 12810632 missense probably damaging 1.00
R5260:Zfp329 UTSW 7 12806526 unclassified probably benign
R5327:Zfp329 UTSW 7 12811494 missense probably benign 0.04
R5679:Zfp329 UTSW 7 12810031 missense probably damaging 0.96
R6886:Zfp329 UTSW 7 12810098 missense probably benign 0.00
R6904:Zfp329 UTSW 7 12806530 unclassified probably benign
R7304:Zfp329 UTSW 7 12810899 missense probably damaging 1.00
R7564:Zfp329 UTSW 7 12811040 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGCCGTCAGCAGTTCCCTTAAC -3'
(R):5'- AGCAGAGGTGTCTGACTCCTTGTC -3'

Sequencing Primer
(F):5'- CTTAACTGCATAACTTGGAGGGC -3'
(R):5'- CCTTTTCAGTATGGAACACGAGAC -3'
Posted On2013-11-08