Incidental Mutation 'R0944:Abcc6'
ID82008
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 6
SynonymsMrp6, DCC, Dyscalc1
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R0944 (G1)
Quality Score196
Status Validated
Chromosome7
Chromosomal Location45967555-46030302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46015505 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 301 (I301F)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002850
AA Change: I301F

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I301F

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTCCTGAGTCCCTGATGTACAC -3'
(R):5'- GCATTCACCATTAACTGGCCTCTGG -3'

Sequencing Primer
(F):5'- GTCCCTGATGTACACACAGAGG -3'
(R):5'- ggtcaaccagggctacag -3'
Posted On2013-11-08