Incidental Mutation 'R0944:Ccdc81'
ID82009
Institutional Source Beutler Lab
Gene Symbol Ccdc81
Ensembl Gene ENSMUSG00000039391
Gene Namecoiled-coil domain containing 81
Synonyms4921513D09Rik
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R0944 (G1)
Quality Score213
Status Validated
Chromosome7
Chromosomal Location89866148-89903629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89866569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 634 (N634S)
Ref Sequence ENSEMBL: ENSMUSP00000044087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041195] [ENSMUST00000131966]
Predicted Effect probably damaging
Transcript: ENSMUST00000041195
AA Change: N634S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044087
Gene: ENSMUSG00000039391
AA Change: N634S

DomainStartEndE-ValueType
Pfam:DUF4496 29 165 2.7e-47 PFAM
low complexity region 224 233 N/A INTRINSIC
low complexity region 344 355 N/A INTRINSIC
coiled coil region 434 468 N/A INTRINSIC
low complexity region 623 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131966
SMART Domains Protein: ENSMUSP00000117788
Gene: ENSMUSG00000039391

DomainStartEndE-ValueType
Pfam:DUF4496 28 165 2e-41 PFAM
Meta Mutation Damage Score 0.3099 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Ccdc81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc81 APN 7 89869615 splice site probably benign
IGL01948:Ccdc81 APN 7 89875855 missense possibly damaging 0.80
IGL02177:Ccdc81 APN 7 89875780 missense possibly damaging 0.94
IGL02396:Ccdc81 APN 7 89881649 missense probably benign
IGL02420:Ccdc81 APN 7 89875738 missense probably benign 0.16
IGL02536:Ccdc81 APN 7 89877580 splice site probably benign
IGL03195:Ccdc81 APN 7 89896708 missense probably benign 0.05
IGL03397:Ccdc81 APN 7 89896828 missense probably damaging 1.00
I0000:Ccdc81 UTSW 7 89898051 missense probably damaging 1.00
R0089:Ccdc81 UTSW 7 89893116 missense possibly damaging 0.87
R0409:Ccdc81 UTSW 7 89886215 missense probably benign 0.01
R0449:Ccdc81 UTSW 7 89890471 missense probably damaging 1.00
R0490:Ccdc81 UTSW 7 89887762 missense probably benign 0.28
R0511:Ccdc81 UTSW 7 89893296 missense probably damaging 1.00
R0562:Ccdc81 UTSW 7 89903229 missense probably benign 0.02
R0801:Ccdc81 UTSW 7 89887658 intron probably null
R1006:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1334:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1526:Ccdc81 UTSW 7 89875873 missense probably damaging 0.99
R1623:Ccdc81 UTSW 7 89886182 missense probably benign 0.00
R1753:Ccdc81 UTSW 7 89866561 missense probably benign 0.03
R1885:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1886:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1887:Ccdc81 UTSW 7 89866611 missense possibly damaging 0.80
R1889:Ccdc81 UTSW 7 89882294 nonsense probably null
R1964:Ccdc81 UTSW 7 89886153 missense probably benign
R1997:Ccdc81 UTSW 7 89898063 missense probably damaging 1.00
R3725:Ccdc81 UTSW 7 89866630 missense possibly damaging 0.95
R5494:Ccdc81 UTSW 7 89877573 missense probably damaging 1.00
R5660:Ccdc81 UTSW 7 89893129 missense probably benign
R6275:Ccdc81 UTSW 7 89882311 missense possibly damaging 0.59
R6434:Ccdc81 UTSW 7 89876144 missense probably damaging 1.00
R6711:Ccdc81 UTSW 7 89887798 missense probably damaging 0.98
R7287:Ccdc81 UTSW 7 89893123 missense probably damaging 0.98
R7582:Ccdc81 UTSW 7 89876145 missense probably damaging 0.99
X0061:Ccdc81 UTSW 7 89877489 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCGAAGTTCAGGGAATACGCAGG -3'
(R):5'- TGTTGGGGAGGTACTAGCACACAG -3'

Sequencing Primer
(F):5'- ACACGCAGGAAATAATTAGTCG -3'
(R):5'- GGTACTAGCACACAGCCTTTG -3'
Posted On2013-11-08