Incidental Mutation 'R0944:Coro2b'
ID82012
Institutional Source Beutler Lab
Gene Symbol Coro2b
Ensembl Gene ENSMUSG00000041729
Gene Namecoronin, actin binding protein, 2B
Synonyms
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location62419492-62537044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62427981 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 308 (S308G)
Ref Sequence ENSEMBL: ENSMUSP00000041826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048043] [ENSMUST00000164246] [ENSMUST00000173171] [ENSMUST00000174439]
Predicted Effect probably benign
Transcript: ENSMUST00000048043
AA Change: S308G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041826
Gene: ENSMUSG00000041729
AA Change: S308G

DomainStartEndE-ValueType
DUF1899 10 74 2.89e-31 SMART
WD40 73 116 8.75e-5 SMART
WD40 126 166 4.95e-4 SMART
WD40 169 208 1.33e-4 SMART
WD40 211 254 2.56e1 SMART
DUF1900 261 397 1.62e-84 SMART
coiled coil region 436 476 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131981
AA Change: S7G
SMART Domains Protein: ENSMUSP00000133481
Gene: ENSMUSG00000041729
AA Change: S7G

DomainStartEndE-ValueType
DUF1900 3 97 6.37e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151604
Predicted Effect probably benign
Transcript: ENSMUST00000164246
AA Change: S303G

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128441
Gene: ENSMUSG00000041729
AA Change: S303G

DomainStartEndE-ValueType
DUF1899 5 69 2.89e-31 SMART
WD40 68 111 8.75e-5 SMART
WD40 121 161 4.95e-4 SMART
WD40 164 203 1.33e-4 SMART
WD40 206 249 2.56e1 SMART
DUF1900 256 317 5.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173171
SMART Domains Protein: ENSMUSP00000134709
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
DUF1899 16 80 2.89e-31 SMART
Pfam:WD40 87 121 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174439
SMART Domains Protein: ENSMUSP00000134079
Gene: ENSMUSG00000041729

DomainStartEndE-ValueType
WD40 1 41 4.95e-4 SMART
WD40 44 83 1.33e-4 SMART
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Homozygous knockout reduces susceptibility to Doxorubicin-induced focal segmental glomerulosclerosis with lower levels of proteinuria and less renal glomerulus damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Coro2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Coro2b APN 9 62425808 missense probably damaging 0.99
IGL01834:Coro2b APN 9 62431357 missense possibly damaging 0.93
IGL03242:Coro2b APN 9 62428961 nonsense probably null
PIT4151001:Coro2b UTSW 9 62429004 missense probably damaging 1.00
R0422:Coro2b UTSW 9 62427977 missense probably benign 0.00
R0835:Coro2b UTSW 9 62425837 missense possibly damaging 0.68
R1115:Coro2b UTSW 9 62431327 missense probably damaging 0.96
R1254:Coro2b UTSW 9 62428965 missense probably damaging 0.98
R1422:Coro2b UTSW 9 62428947 critical splice donor site probably null
R1532:Coro2b UTSW 9 62489423 missense probably damaging 1.00
R1543:Coro2b UTSW 9 62425841 missense probably benign 0.32
R3424:Coro2b UTSW 9 62429308 splice site probably null
R3971:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R3972:Coro2b UTSW 9 62429240 missense possibly damaging 0.55
R4035:Coro2b UTSW 9 62425789 unclassified probably benign
R4233:Coro2b UTSW 9 62426185 missense possibly damaging 0.69
R4734:Coro2b UTSW 9 62426578 missense probably benign 0.02
R4825:Coro2b UTSW 9 62454623 missense probably benign 0.30
R5332:Coro2b UTSW 9 62429230 missense probably damaging 0.97
R5702:Coro2b UTSW 9 62426577 missense probably damaging 0.97
R6474:Coro2b UTSW 9 62426628 missense probably benign 0.16
R6500:Coro2b UTSW 9 62489324 missense probably benign 0.24
R6674:Coro2b UTSW 9 62432427 missense probably damaging 1.00
R7102:Coro2b UTSW 9 62421385 missense possibly damaging 0.81
R7347:Coro2b UTSW 9 62489372 missense probably benign
R8199:Coro2b UTSW 9 62429020 missense probably benign 0.00
R8447:Coro2b UTSW 9 62426560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTGCTGACAGAGATAGCC -3'
(R):5'- CCTGCCCCTAGTAGAGCTACCAAG -3'

Sequencing Primer
(F):5'- TGCCATGAGTGACAGGCTG -3'
(R):5'- CTACCAAGGCACAGGGTTAG -3'
Posted On2013-11-08