Incidental Mutation 'R0944:Pmel'
ID82015
Institutional Source Beutler Lab
Gene Symbol Pmel
Ensembl Gene ENSMUSG00000025359
Gene Namepremelanosome protein
SynonymsPmel17, gp100, D10H12S53E, Si, D12S53Eh, gp87
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128704195-128720238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128715257 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 123 (Q123L)
Ref Sequence ENSEMBL: ENSMUSP00000051869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000054125] [ENSMUST00000217836] [ENSMUST00000219157] [ENSMUST00000219834]
Predicted Effect probably benign
Transcript: ENSMUST00000026414
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000054125
AA Change: Q123L

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051869
Gene: ENSMUSG00000025359
AA Change: Q123L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
PKD 228 310 3.17e-7 SMART
low complexity region 326 348 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217836
AA Change: Q123L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219157
AA Change: Q123L

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000219834
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a melanocyte-specific type I transmembrane glycoprotein. The encoded protein is enriched in melanosomes, which are the melanin-producing organelles in melanocytes, and plays an essential role in the structural organization of premelanosomes. This protein is involved in generating internal matrix fibers that define the transition from Stage I to Stage II melanosomes. This protein undergoes a complex pattern of prosttranslational processing and modification that is essential to the proper functioning of the protein. A secreted form of this protein that is released by proteolytic ectodomain shedding may be used as a melanoma-specific serum marker. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2011]
PHENOTYPE: This mutation affects the viability of melanoblasts, resulting in random occurrence of white, partially white or gray hairs, and fully pigmented hairs that together display as varying intensities of silvering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Pmel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Pmel APN 10 128716089 missense possibly damaging 0.83
IGL01788:Pmel APN 10 128717832 missense probably damaging 1.00
IGL03205:Pmel APN 10 128716448 missense probably benign 0.05
R0288:Pmel UTSW 10 128714306 missense probably benign
R1220:Pmel UTSW 10 128714060 missense probably benign 0.01
R1429:Pmel UTSW 10 128718992 splice site probably null
R5222:Pmel UTSW 10 128718984 unclassified probably null
R5689:Pmel UTSW 10 128716301 missense probably damaging 1.00
R5767:Pmel UTSW 10 128714381 missense probably damaging 0.99
R6145:Pmel UTSW 10 128715935 missense probably damaging 1.00
R7287:Pmel UTSW 10 128715226 nonsense probably null
R7410:Pmel UTSW 10 128716484 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAGTTGTGGTGTCCATAAATCCCCG -3'
(R):5'- TGAAGGTTGAACTGGCGTGAGC -3'

Sequencing Primer
(F):5'- TGCCATCTTACATGGGTTATAGTATG -3'
(R):5'- TGGTAGACAGTCACTTCCATTG -3'
Posted On2013-11-08