Mutagenetix > Incidental Mutations

Incidental Mutation 'R0944:Col22a1'

82026

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

039083-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 71881662 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 130 (I130V)

Ref Sequence

ENSEMBL: ENSMUSP00000124270 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000160513] [ENSMUST00000229585]

Predicted Effect

unknown
Transcript: ENSMUST00000159993
AA Change: I1019V

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: I1019V

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000160513
AA Change: I130V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000124270
Gene: ENSMUSG00000079022
AA Change: I130V

Domain	Start	End	E-Value	Type
Pfam:Collagen	1	60	5.7e-13	PFAM
Pfam:Collagen	43	102	1.3e-12	PFAM
Pfam:Collagen	100	143	2.2e-8	PFAM
Pfam:Collagen	142	194	1.9e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000229585
AA Change: I464V

Meta Mutation Damage Score

0.0578

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110018I06Rik	G	A	12: 107,489,009	R118K	unknown	Het
Abcc6	T	A	7: 46,015,505	I301F	possibly damaging	Het
Akap9	C	A	5: 4,064,742		probably null	Het
Alg6	A	G	4: 99,762,060	I506V	probably benign	Het
B3gat1	C	T	9: 26,756,941	R276C	probably damaging	Het
Camk1	A	G	6: 113,338,391	Y105H	probably damaging	Het
Ccdc81	T	C	7: 89,866,569	N634S	probably damaging	Het
Clcn1	C	A	6: 42,313,141	Q837K	probably benign	Het
Clec16a	A	G	16: 10,688,646		probably benign	Het
Coro2b	T	C	9: 62,427,981	S308G	probably benign	Het
Cpxm1	A	G	2: 130,397,503	W2R	probably damaging	Het
Csmd3	T	C	15: 47,611,831	N3364S	probably damaging	Het
Dgkq	A	G	5: 108,656,465	V131A	probably damaging	Het
Dnaic1	A	G	4: 41,629,997	S469G	probably benign	Het
Eml4	G	A	17: 83,478,060	E885K	probably benign	Het
Etfa	A	T	9: 55,488,838	I148N	probably damaging	Het
Gm11639	T	G	11: 104,710,730		probably null	Het
Gpbar1	A	G	1: 74,279,522	D308G	probably benign	Het
Gprin3	T	C	6: 59,353,915	E469G	possibly damaging	Het
Igkv1-115	T	C	6: 68,161,683	V90A	probably damaging	Het
Ints2	A	G	11: 86,244,463	V375A	possibly damaging	Het
Mindy3	T	C	2: 12,396,182	M242V	possibly damaging	Het
Olfr1094	A	C	2: 86,828,937	I62L	probably benign	Het
Olfr279	A	G	15: 98,497,684	I71V	probably benign	Het
Olfr353	T	C	2: 36,890,686	H54R	probably damaging	Het
P3h1	G	A	4: 119,238,759	E355K	probably benign	Het
Paxbp1	T	C	16: 91,023,427	T703A	probably benign	Het
Pcdh15	A	T	10: 74,210,470	Y193F	probably damaging	Het
Pdxdc1	A	G	16: 13,838,369	V613A	probably damaging	Het
Plekha5	T	C	6: 140,570,196		probably benign	Het
Pmel	A	T	10: 128,715,257	Q123L	possibly damaging	Het
Prl6a1	T	C	13: 27,318,166		probably benign	Het
Rcan1	T	C	16: 92,393,491	T187A	probably damaging	Het
Rp1l1	A	G	14: 64,032,232	S1756G	probably benign	Het
Runx2	A	T	17: 44,608,236	M405K	probably damaging	Het
Serinc5	T	C	13: 92,661,105	Y39H	probably damaging	Het
Sgsm1	G	A	5: 113,265,874	T676I	probably benign	Het
Slc6a15	G	C	10: 103,409,796	V547L	probably benign	Het
Slk	T	C	19: 47,608,993	I80T	probably damaging	Het
Spice1	A	G	16: 44,384,761	N810S	probably benign	Het
Spred2	A	G	11: 20,001,104		probably benign	Het
Tbc1d4	C	G	14: 101,479,220		probably benign	Het
Tdrd7	G	A	4: 46,029,762	V1032M	probably benign	Het
Tlr11	A	G	14: 50,362,336	N593S	probably benign	Het
Trpa1	T	C	1: 14,912,361		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp25	T	C	16: 77,081,447		probably benign	Het
Vmn2r97	T	A	17: 18,947,403	S640T	probably benign	Het
Zc3h6	A	G	2: 129,006,816	Y321C	probably damaging	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R1932:Col22a1	UTSW	15	71870140	missense	unknown
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TGTCCTTGCTCAAGTCAATAAGCCC -3'
(R):5'- AGAGAGAAGATGCGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- TGTGTTCACACAGGGAAGTC -3'
(R):5'- GCATGTTGTAATGGAGGTTGGAC -3'

Posted On

2013-11-08