Incidental Mutation 'R0944:Spice1'
ID82030
Institutional Source Beutler Lab
Gene Symbol Spice1
Ensembl Gene ENSMUSG00000043065
Gene Namespindle and centriole associated protein 1
SynonymsCcdc52, D16Ertd480e
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0944 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44347121-44388497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44384761 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 810 (N810S)
Ref Sequence ENSEMBL: ENSMUSP00000058832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050897]
Predicted Effect probably benign
Transcript: ENSMUST00000050897
AA Change: N810S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058832
Gene: ENSMUSG00000043065
AA Change: N810S

DomainStartEndE-ValueType
Pfam:SPICE 33 436 1.4e-151 PFAM
low complexity region 627 642 N/A INTRINSIC
coiled coil region 729 757 N/A INTRINSIC
low complexity region 758 775 N/A INTRINSIC
low complexity region 804 824 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133168
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Vmn2r97 T A 17: 18,947,403 S640T probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Spice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Spice1 APN 16 44366630 missense probably benign 0.20
IGL01688:Spice1 APN 16 44384710 missense probably benign 0.04
IGL03259:Spice1 APN 16 44356167 missense probably damaging 1.00
IGL03367:Spice1 APN 16 44356178 missense probably damaging 0.99
R0230:Spice1 UTSW 16 44365576 splice site probably benign
R1352:Spice1 UTSW 16 44386822 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1888:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1894:Spice1 UTSW 16 44365626 missense probably damaging 1.00
R1907:Spice1 UTSW 16 44357830 nonsense probably null
R2404:Spice1 UTSW 16 44366626 missense probably benign 0.29
R2444:Spice1 UTSW 16 44366568 nonsense probably null
R3551:Spice1 UTSW 16 44357869 missense probably damaging 0.96
R3848:Spice1 UTSW 16 44378891 nonsense probably null
R3857:Spice1 UTSW 16 44355443 missense probably damaging 1.00
R4490:Spice1 UTSW 16 44382113 missense probably damaging 1.00
R5593:Spice1 UTSW 16 44370752 missense possibly damaging 0.50
R5996:Spice1 UTSW 16 44384674 missense probably benign 0.00
R6303:Spice1 UTSW 16 44370697 missense probably benign 0.03
R6552:Spice1 UTSW 16 44379033 missense possibly damaging 0.75
R7042:Spice1 UTSW 16 44385680 missense probably benign 0.04
R7062:Spice1 UTSW 16 44357896 missense probably damaging 1.00
R7065:Spice1 UTSW 16 44355535 missense probably damaging 1.00
R7115:Spice1 UTSW 16 44379275 missense probably benign 0.00
R7762:Spice1 UTSW 16 44370501 splice site probably null
R8408:Spice1 UTSW 16 44384697 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTTCCCCAATGTATCGTAGGGC -3'
(R):5'- TGCAAGGATGAAAGTGCTACCAGTC -3'

Sequencing Primer
(F):5'- CTGGCATTCTGTAAACTGGC -3'
(R):5'- CAGTCAATGTATCTACCCTGGGAG -3'
Posted On2013-11-08