Incidental Mutation 'R0944:Vmn2r97'
ID82034
Institutional Source Beutler Lab
Gene Symbol Vmn2r97
Ensembl Gene ENSMUSG00000091491
Gene Namevomeronasal 2, receptor 97
SynonymsEG627367
MMRRC Submission 039083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0944 (G1)
Quality Score172
Status Validated
Chromosome17
Chromosomal Location18914300-18958087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18947403 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 640 (S640T)
Ref Sequence ENSEMBL: ENSMUSP00000129313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168710] [ENSMUST00000232219]
Predicted Effect probably benign
Transcript: ENSMUST00000168710
AA Change: S640T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129313
Gene: ENSMUSG00000091491
AA Change: S640T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 82 442 2.9e-36 PFAM
Pfam:NCD3G 513 566 4.9e-21 PFAM
Pfam:7tm_3 599 834 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232219
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110018I06Rik G A 12: 107,489,009 R118K unknown Het
Abcc6 T A 7: 46,015,505 I301F possibly damaging Het
Akap9 C A 5: 4,064,742 probably null Het
Alg6 A G 4: 99,762,060 I506V probably benign Het
B3gat1 C T 9: 26,756,941 R276C probably damaging Het
Camk1 A G 6: 113,338,391 Y105H probably damaging Het
Ccdc81 T C 7: 89,866,569 N634S probably damaging Het
Clcn1 C A 6: 42,313,141 Q837K probably benign Het
Clec16a A G 16: 10,688,646 probably benign Het
Col22a1 T C 15: 71,881,662 I130V probably benign Het
Coro2b T C 9: 62,427,981 S308G probably benign Het
Cpxm1 A G 2: 130,397,503 W2R probably damaging Het
Csmd3 T C 15: 47,611,831 N3364S probably damaging Het
Dgkq A G 5: 108,656,465 V131A probably damaging Het
Dnaic1 A G 4: 41,629,997 S469G probably benign Het
Eml4 G A 17: 83,478,060 E885K probably benign Het
Etfa A T 9: 55,488,838 I148N probably damaging Het
Gm11639 T G 11: 104,710,730 probably null Het
Gpbar1 A G 1: 74,279,522 D308G probably benign Het
Gprin3 T C 6: 59,353,915 E469G possibly damaging Het
Igkv1-115 T C 6: 68,161,683 V90A probably damaging Het
Ints2 A G 11: 86,244,463 V375A possibly damaging Het
Mindy3 T C 2: 12,396,182 M242V possibly damaging Het
Olfr1094 A C 2: 86,828,937 I62L probably benign Het
Olfr279 A G 15: 98,497,684 I71V probably benign Het
Olfr353 T C 2: 36,890,686 H54R probably damaging Het
P3h1 G A 4: 119,238,759 E355K probably benign Het
Paxbp1 T C 16: 91,023,427 T703A probably benign Het
Pcdh15 A T 10: 74,210,470 Y193F probably damaging Het
Pdxdc1 A G 16: 13,838,369 V613A probably damaging Het
Plekha5 T C 6: 140,570,196 probably benign Het
Pmel A T 10: 128,715,257 Q123L possibly damaging Het
Prl6a1 T C 13: 27,318,166 probably benign Het
Rcan1 T C 16: 92,393,491 T187A probably damaging Het
Rp1l1 A G 14: 64,032,232 S1756G probably benign Het
Runx2 A T 17: 44,608,236 M405K probably damaging Het
Serinc5 T C 13: 92,661,105 Y39H probably damaging Het
Sgsm1 G A 5: 113,265,874 T676I probably benign Het
Slc6a15 G C 10: 103,409,796 V547L probably benign Het
Slk T C 19: 47,608,993 I80T probably damaging Het
Spice1 A G 16: 44,384,761 N810S probably benign Het
Spred2 A G 11: 20,001,104 probably benign Het
Tbc1d4 C G 14: 101,479,220 probably benign Het
Tdrd7 G A 4: 46,029,762 V1032M probably benign Het
Tlr11 A G 14: 50,362,336 N593S probably benign Het
Trpa1 T C 1: 14,912,361 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp25 T C 16: 77,081,447 probably benign Het
Zc3h6 A G 2: 129,006,816 Y321C probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Vmn2r97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r97 APN 17 18947659 missense probably benign 0.37
IGL00962:Vmn2r97 APN 17 18929228 missense probably damaging 1.00
IGL01704:Vmn2r97 APN 17 18947811 missense probably damaging 0.99
IGL01888:Vmn2r97 APN 17 18929024 nonsense probably null
IGL02429:Vmn2r97 APN 17 18930334 missense possibly damaging 0.94
IGL02742:Vmn2r97 APN 17 18929170 missense probably damaging 0.97
IGL02934:Vmn2r97 APN 17 18929685 missense probably benign 0.00
IGL02978:Vmn2r97 APN 17 18948036 missense probably benign 0.01
IGL03230:Vmn2r97 APN 17 18929406 missense probably benign 0.10
IGL03241:Vmn2r97 APN 17 18928176 missense probably benign 0.11
IGL03050:Vmn2r97 UTSW 17 18947638 missense possibly damaging 0.84
PIT4469001:Vmn2r97 UTSW 17 18929616 missense probably benign 0.00
R0482:Vmn2r97 UTSW 17 18947668 missense probably damaging 1.00
R0514:Vmn2r97 UTSW 17 18914472 missense probably benign 0.25
R1061:Vmn2r97 UTSW 17 18928178 nonsense probably null
R1546:Vmn2r97 UTSW 17 18947848 missense probably damaging 1.00
R1725:Vmn2r97 UTSW 17 18929135 missense probably benign 0.43
R1860:Vmn2r97 UTSW 17 18947386 missense probably benign 0.01
R1938:Vmn2r97 UTSW 17 18929331 missense probably benign 0.01
R1944:Vmn2r97 UTSW 17 18940238 missense probably benign 0.00
R2027:Vmn2r97 UTSW 17 18929682 missense unknown
R2106:Vmn2r97 UTSW 17 18947838 missense probably damaging 1.00
R2151:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2153:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2154:Vmn2r97 UTSW 17 18947322 nonsense probably null
R2516:Vmn2r97 UTSW 17 18947552 missense probably benign
R3739:Vmn2r97 UTSW 17 18928151 missense probably damaging 1.00
R3744:Vmn2r97 UTSW 17 18929628 missense probably benign
R3885:Vmn2r97 UTSW 17 18928334 missense possibly damaging 0.90
R3899:Vmn2r97 UTSW 17 18947611 missense probably damaging 0.96
R4115:Vmn2r97 UTSW 17 18928070 missense probably benign 0.01
R4247:Vmn2r97 UTSW 17 18947280 missense possibly damaging 0.83
R4287:Vmn2r97 UTSW 17 18948075 intron probably benign
R4439:Vmn2r97 UTSW 17 18930354 missense probably benign 0.00
R4523:Vmn2r97 UTSW 17 18929071 missense probably benign 0.03
R4783:Vmn2r97 UTSW 17 18929288 missense probably benign
R4948:Vmn2r97 UTSW 17 18947299 missense possibly damaging 0.95
R4981:Vmn2r97 UTSW 17 18940174 nonsense probably null
R5029:Vmn2r97 UTSW 17 18947911 missense probably damaging 1.00
R5200:Vmn2r97 UTSW 17 18928353 missense probably damaging 1.00
R5541:Vmn2r97 UTSW 17 18928355 nonsense probably null
R5637:Vmn2r97 UTSW 17 18947366 nonsense probably null
R5765:Vmn2r97 UTSW 17 18947180 nonsense probably null
R5885:Vmn2r97 UTSW 17 18947773 missense possibly damaging 0.50
R6272:Vmn2r97 UTSW 17 18947599 missense possibly damaging 0.70
R6553:Vmn2r97 UTSW 17 18930304 nonsense probably null
R6818:Vmn2r97 UTSW 17 18947931 missense possibly damaging 0.95
R6880:Vmn2r97 UTSW 17 18914508 missense probably benign 0.00
R7012:Vmn2r97 UTSW 17 18947494 missense probably damaging 0.99
R7023:Vmn2r97 UTSW 17 18914401 missense probably damaging 1.00
R7044:Vmn2r97 UTSW 17 18914367 missense probably benign 0.05
R7191:Vmn2r97 UTSW 17 18930286 missense probably damaging 1.00
R7503:Vmn2r97 UTSW 17 18928208 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCTGGCCTATGAAGACCCCTTG -3'
(R):5'- GGGGATGTTGCCATCCATATTCCAC -3'

Sequencing Primer
(F):5'- CTTGGGGATGGTATTAGCAAGC -3'
(R):5'- CATATAGGAATGATGTAGTTTGGCCC -3'
Posted On2013-11-08