Mutagenetix > Incidental Mutations

Incidental Mutation 'R0944:Runx2'

82035

Institutional Source

Beutler Lab

Gene Symbol

Runx2

Ensembl Gene

ENSMUSG00000039153

Gene Name

runt related transcription factor 2

Synonyms

polyomavirus enhancer binding factor 2 (PEBP2), Pebpa2a, AML3, Osf2, PEBP2aA, PEBP2 alpha A, Cbfa1, SL3-3 enhancer factor 1

MMRRC Submission

039083-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44495987-44814797 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44608236 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 405 (M405K)

Ref Sequence

ENSEMBL: ENSMUSP00000109202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113568] [ENSMUST00000113571] [ENSMUST00000113572] [ENSMUST00000159943] [ENSMUST00000160673] [ENSMUST00000162373] [ENSMUST00000162629] [ENSMUST00000162816] [ENSMUST00000162878]

Predicted Effect

probably benign
Transcript: ENSMUST00000113568

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113571
AA Change: M419K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109201
Gene: ENSMUSG00000039153
AA Change: M419K

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	9.2e-83	PFAM
Pfam:RunxI	434	528	7.6e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000113572
AA Change: M405K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109202
Gene: ENSMUSG00000039153
AA Change: M405K

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	31	75	N/A	INTRINSIC
Pfam:Runt	92	226	3.6e-83	PFAM
Pfam:RunxI	420	514	2.7e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159943
AA Change: M419K

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124918
Gene: ENSMUSG00000039153
AA Change: M419K

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	9.2e-83	PFAM
Pfam:RunxI	434	528	7.6e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160673
AA Change: M487K

PolyPhen 2 Score 0.821 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123743
Gene: ENSMUSG00000039153
AA Change: M487K

Domain	Start	End	E-Value	Type
low complexity region	89	101	N/A	INTRINSIC
coiled coil region	113	157	N/A	INTRINSIC
Pfam:Runt	177	306	3.9e-75	PFAM
Pfam:RunxI	505	596	3.2e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162130

SMART Domains

Protein: ENSMUSP00000124199
Gene: ENSMUSG00000039153

Domain	Start	End	E-Value	Type
Pfam:Runt	6	135	8e-76	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162373
AA Change: M383K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000124494
Gene: ENSMUSG00000039153
AA Change: M383K

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	31	75	N/A	INTRINSIC
Pfam:Runt	92	226	3.3e-83	PFAM
Pfam:RunxI	398	492	2.5e-45	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162629
AA Change: M397K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124374
Gene: ENSMUSG00000039153
AA Change: M397K

Domain	Start	End	E-Value	Type
low complexity region	21	33	N/A	INTRINSIC
coiled coil region	45	89	N/A	INTRINSIC
Pfam:Runt	106	240	3.5e-83	PFAM
Pfam:RunxI	412	506	2.7e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162816

SMART Domains

Protein: ENSMUSP00000125498
Gene: ENSMUSG00000039153

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	31	75	N/A	INTRINSIC
Pfam:Runt	92	226	8e-83	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162878
AA Change: M312K

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123707
Gene: ENSMUSG00000039153
AA Change: M312K

Domain	Start	End	E-Value	Type
Pfam:Med15	6	224	1.4e-6	PFAM
Pfam:Runt	92	192	8.1e-54	PFAM
Pfam:RunxI	327	420	5.8e-41	PFAM

Meta Mutation Damage Score

0.5103

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.3%
20x: 94.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a member of the runt domain-containing family of transcription factors. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, decreased body weight, abnormal hematopoiesis, and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110018I06Rik	G	A	12: 107,489,009	R118K	unknown	Het
Abcc6	T	A	7: 46,015,505	I301F	possibly damaging	Het
Akap9	C	A	5: 4,064,742		probably null	Het
Alg6	A	G	4: 99,762,060	I506V	probably benign	Het
B3gat1	C	T	9: 26,756,941	R276C	probably damaging	Het
Camk1	A	G	6: 113,338,391	Y105H	probably damaging	Het
Ccdc81	T	C	7: 89,866,569	N634S	probably damaging	Het
Clcn1	C	A	6: 42,313,141	Q837K	probably benign	Het
Clec16a	A	G	16: 10,688,646		probably benign	Het
Col22a1	T	C	15: 71,881,662	I130V	probably benign	Het
Coro2b	T	C	9: 62,427,981	S308G	probably benign	Het
Cpxm1	A	G	2: 130,397,503	W2R	probably damaging	Het
Csmd3	T	C	15: 47,611,831	N3364S	probably damaging	Het
Dgkq	A	G	5: 108,656,465	V131A	probably damaging	Het
Dnaic1	A	G	4: 41,629,997	S469G	probably benign	Het
Eml4	G	A	17: 83,478,060	E885K	probably benign	Het
Etfa	A	T	9: 55,488,838	I148N	probably damaging	Het
Gm11639	T	G	11: 104,710,730		probably null	Het
Gpbar1	A	G	1: 74,279,522	D308G	probably benign	Het
Gprin3	T	C	6: 59,353,915	E469G	possibly damaging	Het
Igkv1-115	T	C	6: 68,161,683	V90A	probably damaging	Het
Ints2	A	G	11: 86,244,463	V375A	possibly damaging	Het
Mindy3	T	C	2: 12,396,182	M242V	possibly damaging	Het
Olfr1094	A	C	2: 86,828,937	I62L	probably benign	Het
Olfr279	A	G	15: 98,497,684	I71V	probably benign	Het
Olfr353	T	C	2: 36,890,686	H54R	probably damaging	Het
P3h1	G	A	4: 119,238,759	E355K	probably benign	Het
Paxbp1	T	C	16: 91,023,427	T703A	probably benign	Het
Pcdh15	A	T	10: 74,210,470	Y193F	probably damaging	Het
Pdxdc1	A	G	16: 13,838,369	V613A	probably damaging	Het
Plekha5	T	C	6: 140,570,196		probably benign	Het
Pmel	A	T	10: 128,715,257	Q123L	possibly damaging	Het
Prl6a1	T	C	13: 27,318,166		probably benign	Het
Rcan1	T	C	16: 92,393,491	T187A	probably damaging	Het
Rp1l1	A	G	14: 64,032,232	S1756G	probably benign	Het
Serinc5	T	C	13: 92,661,105	Y39H	probably damaging	Het
Sgsm1	G	A	5: 113,265,874	T676I	probably benign	Het
Slc6a15	G	C	10: 103,409,796	V547L	probably benign	Het
Slk	T	C	19: 47,608,993	I80T	probably damaging	Het
Spice1	A	G	16: 44,384,761	N810S	probably benign	Het
Spred2	A	G	11: 20,001,104		probably benign	Het
Tbc1d4	C	G	14: 101,479,220		probably benign	Het
Tdrd7	G	A	4: 46,029,762	V1032M	probably benign	Het
Tlr11	A	G	14: 50,362,336	N593S	probably benign	Het
Trpa1	T	C	1: 14,912,361		probably null	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Usp25	T	C	16: 77,081,447		probably benign	Het
Vmn2r97	T	A	17: 18,947,403	S640T	probably benign	Het
Zc3h6	A	G	2: 129,006,816	Y321C	probably damaging	Het
Zfp329	T	A	7: 12,811,468	N43I	probably benign	Het

Other mutations in Runx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02020:Runx2	APN	17	44658599	missense	probably damaging	1.00
IGL02029:Runx2	APN	17	44658687	nonsense	probably null
IGL02084:Runx2	APN	17	44724829	missense	probably damaging	1.00
R0040:Runx2	UTSW	17	44608254	missense	possibly damaging	0.58
R0627:Runx2	UTSW	17	44658505	intron	probably benign
R1514:Runx2	UTSW	17	44735337	missense	possibly damaging	0.54
R2069:Runx2	UTSW	17	44735342	missense	probably benign	0.19
R3976:Runx2	UTSW	17	44610079	missense	possibly damaging	0.91
R4686:Runx2	UTSW	17	44639685	missense	probably damaging	1.00
R4911:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R5241:Runx2	UTSW	17	44639777	nonsense	probably null
R5526:Runx2	UTSW	17	44724862	missense	probably damaging	1.00
R6566:Runx2	UTSW	17	44814488	critical splice donor site	probably null
R6874:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R6875:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R6980:Runx2	UTSW	17	44735316	missense	possibly damaging	0.65
R7008:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7009:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7057:Runx2	UTSW	17	44814537	missense	probably null
R7085:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7175:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7176:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7177:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7181:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7231:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7232:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7254:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7267:Runx2	UTSW	17	44814192	missense	probably damaging	1.00
R7835:Runx2	UTSW	17	44608236	missense	probably damaging	0.99
R7949:Runx2	UTSW	17	44735555	missense	possibly damaging	0.45
R8474:Runx2	UTSW	17	44608260	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCGTCAGCGTCAACACCATC -3'
(R):5'- ACTTGCTGTGCCTTGGGAGAAAG -3'

Sequencing Primer
(F):5'- GCGTCAACACCATCATTCTGG -3'
(R):5'- ATTGATATTTACAGATGTTTCCCTCC -3'

Posted On

2013-11-08