Incidental Mutation 'R0945:Rbak'
ID82053
Institutional Source Beutler Lab
Gene Symbol Rbak
Ensembl Gene ENSMUSG00000061898
Gene NameRB-associated KRAB zinc finger
Synonyms
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R0945 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location143172186-143180775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143173579 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 573 (F573Y)
Ref Sequence ENSEMBL: ENSMUSP00000128731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049861] [ENSMUST00000165318]
Predicted Effect probably damaging
Transcript: ENSMUST00000049861
AA Change: F573Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059273
Gene: ENSMUSG00000061898
AA Change: F573Y

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165318
AA Change: F573Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128731
Gene: ENSMUSG00000061898
AA Change: F573Y

DomainStartEndE-ValueType
KRAB 8 68 6.89e-36 SMART
ZnF_C2H2 258 280 1.1e-2 SMART
ZnF_C2H2 286 308 1.4e-4 SMART
ZnF_C2H2 314 336 5.21e-4 SMART
ZnF_C2H2 342 364 1.95e-3 SMART
ZnF_C2H2 370 392 2.3e-5 SMART
ZnF_C2H2 398 420 3.95e-4 SMART
ZnF_C2H2 426 448 5.59e-4 SMART
ZnF_C2H2 454 476 1.12e-3 SMART
ZnF_C2H2 508 528 1.4e1 SMART
ZnF_C2H2 536 558 3.89e-3 SMART
ZnF_C2H2 564 586 1.04e-3 SMART
ZnF_C2H2 592 614 5.42e-2 SMART
ZnF_C2H2 620 642 1.5e-4 SMART
ZnF_C2H2 648 670 9.22e-5 SMART
ZnF_C2H2 676 698 5.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166382
SMART Domains Protein: ENSMUSP00000132239
Gene: ENSMUSG00000061898

DomainStartEndE-ValueType
KRAB 27 87 6.89e-36 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 1.4e-4 SMART
ZnF_C2H2 333 355 5.21e-4 SMART
ZnF_C2H2 361 383 1.95e-3 SMART
ZnF_C2H2 389 411 2.3e-5 SMART
ZnF_C2H2 417 439 3.95e-4 SMART
ZnF_C2H2 445 467 5.59e-4 SMART
ZnF_C2H2 473 495 1.12e-3 SMART
ZnF_C2H2 527 547 1.4e1 SMART
ZnF_C2H2 555 577 3.89e-3 SMART
ZnF_C2H2 583 605 1.04e-3 SMART
ZnF_C2H2 611 633 5.42e-2 SMART
ZnF_C2H2 639 661 1.5e-4 SMART
ZnF_C2H2 667 689 9.22e-5 SMART
ZnF_C2H2 695 717 5.21e-4 SMART
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which interacts with the tumor suppressor retinoblastoma 1. The two interacting proteins are thought to act as a transcriptional repressor for promoters which are activated by the E2F1 transcription factor. This protein contains a Kruppel-associated box (KRAB), which is a transcriptional repressor motif. Read-through transcripts that include exons from the downstream gene LOC389458 are expressed from this locus. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Ppcdc C T 9: 57,420,158 probably null Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Rbak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Rbak APN 5 143176600 splice site probably benign
R0117:Rbak UTSW 5 143173632 nonsense probably null
R0514:Rbak UTSW 5 143173414 missense probably damaging 0.96
R1483:Rbak UTSW 5 143174344 missense probably damaging 1.00
R1796:Rbak UTSW 5 143173447 missense probably damaging 1.00
R1916:Rbak UTSW 5 143176116 missense probably damaging 1.00
R1960:Rbak UTSW 5 143174682 nonsense probably null
R2039:Rbak UTSW 5 143173175 missense probably benign 0.37
R2070:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2071:Rbak UTSW 5 143176584 missense probably damaging 0.99
R2151:Rbak UTSW 5 143176502 missense possibly damaging 0.65
R2877:Rbak UTSW 5 143174105 missense probably damaging 1.00
R4030:Rbak UTSW 5 143173969 missense probably damaging 1.00
R4584:Rbak UTSW 5 143176123 missense probably benign 0.00
R4612:Rbak UTSW 5 143174467 missense probably benign 0.01
R5229:Rbak UTSW 5 143174162 missense probably damaging 1.00
R5518:Rbak UTSW 5 143173309 missense probably damaging 1.00
R5541:Rbak UTSW 5 143173990 missense probably damaging 1.00
R5873:Rbak UTSW 5 143173711 missense probably benign 0.32
R5908:Rbak UTSW 5 143173636 missense probably damaging 1.00
R6053:Rbak UTSW 5 143174682 nonsense probably null
R6416:Rbak UTSW 5 143176552 missense possibly damaging 0.67
R6693:Rbak UTSW 5 143174111 missense probably damaging 0.97
R7041:Rbak UTSW 5 143173471 missense probably damaging 1.00
R7057:Rbak UTSW 5 143173927 missense possibly damaging 0.81
R7341:Rbak UTSW 5 143176072 missense probably benign 0.01
R7454:Rbak UTSW 5 143173773 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTACGGTGAGGTTCGACATCC -3'
(R):5'- CATTAGGCACTGGAAGGTCCATGC -3'

Sequencing Primer
(F):5'- tcgacatccgcgagaac -3'
(R):5'- AGTGTGGAAAGACCTTCCTTGAC -3'
Posted On2013-11-08