Incidental Mutation 'R0945:Ppcdc'
ID82066
Institutional Source Beutler Lab
Gene Symbol Ppcdc
Ensembl Gene ENSMUSG00000063849
Gene Namephosphopantothenoylcysteine decarboxylase
Synonyms1810057I13Rik, 8430432M10Rik
MMRRC Submission 039084-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0945 (G1)
Quality Score181
Status Validated
Chromosome9
Chromosomal Location57385095-57440124 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 57420158 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000085709] [ENSMUST00000213194] [ENSMUST00000213479] [ENSMUST00000214065] [ENSMUST00000214144] [ENSMUST00000214166] [ENSMUST00000214339] [ENSMUST00000214624] [ENSMUST00000215299] [ENSMUST00000215883] [ENSMUST00000216365]
Predicted Effect probably null
Transcript: ENSMUST00000085709
SMART Domains Protein: ENSMUSP00000082856
Gene: ENSMUSG00000063849

DomainStartEndE-ValueType
Pfam:Flavoprotein 18 149 7.9e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213194
Predicted Effect probably benign
Transcript: ENSMUST00000213479
Predicted Effect probably null
Transcript: ENSMUST00000214065
Predicted Effect probably null
Transcript: ENSMUST00000214144
Predicted Effect probably benign
Transcript: ENSMUST00000214166
Predicted Effect probably benign
Transcript: ENSMUST00000214339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214519
Predicted Effect probably benign
Transcript: ENSMUST00000214624
Predicted Effect probably benign
Transcript: ENSMUST00000215299
Predicted Effect probably benign
Transcript: ENSMUST00000215883
Predicted Effect probably null
Transcript: ENSMUST00000215961
Predicted Effect probably benign
Transcript: ENSMUST00000216365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217255
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.1%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Biosynthesis of coenzyme A (CoA) from pantothenic acid (vitamin B5) is an essential universal pathway in prokaryotes and eukaryotes. PPCDC (EC 4.1.1.36), one of the last enzymes in this pathway, converts phosphopantothenoylcysteine to 4-prime-phosphopantetheine (Daugherty et al., 2002 [PubMed 11923312]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,111 M883V probably benign Het
Allc A G 12: 28,559,963 S212P probably benign Het
Anxa10 A G 8: 62,060,245 probably benign Het
Apoa2 A G 1: 171,225,699 probably null Het
Arfgef2 T C 2: 166,826,969 probably benign Het
Arhgap30 G T 1: 171,403,286 V204L probably damaging Het
Cd109 T A 9: 78,688,941 V852E possibly damaging Het
Ceacam5 T A 7: 17,747,344 Y339N probably damaging Het
Chaf1a A G 17: 56,067,441 D876G probably damaging Het
Chd9 A G 8: 90,933,002 K197E possibly damaging Het
Cnr2 A T 4: 135,917,321 M237L probably benign Het
Dnm2 C A 9: 21,505,660 Q830K probably damaging Het
Dst T C 1: 34,271,419 L1615P probably damaging Het
Eid1 A G 2: 125,673,577 D129G probably damaging Het
Exoc5 A G 14: 49,039,342 probably benign Het
Greb1 T C 12: 16,673,802 Y1854C probably benign Het
Il15ra T A 2: 11,718,327 V54E probably damaging Het
Il4i1 G A 7: 44,839,704 V306M probably damaging Het
Lrsam1 T C 2: 32,947,909 D211G probably benign Het
Miga1 A T 3: 152,317,663 F250L possibly damaging Het
Myrfl C T 10: 116,803,394 probably benign Het
Nell1 A G 7: 50,219,585 I203V probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr112 G A 17: 37,563,387 T308I probably benign Het
Olfr1234 T C 2: 89,363,255 Y58C probably damaging Het
Olfr654 T A 7: 104,588,672 N289K probably damaging Het
Pdxdc1 A G 16: 13,857,432 L345P probably damaging Het
Pex3 C A 10: 13,542,676 A79S probably benign Het
Pla2r1 A C 2: 60,458,410 L626R possibly damaging Het
Plcb3 A G 19: 6,954,878 S1107P probably damaging Het
Rbak A T 5: 143,173,579 F573Y probably damaging Het
Rfc1 A G 5: 65,278,709 probably null Het
Rpl13 C T 8: 123,105,174 A203V possibly damaging Het
Scn8a A G 15: 101,015,787 H1020R possibly damaging Het
Slf1 A G 13: 77,103,471 probably benign Het
Synj1 A G 16: 90,960,445 L905S possibly damaging Het
Tmem59 T A 4: 107,187,725 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uri1 A T 7: 37,969,678 D127E probably damaging Het
Usp31 T C 7: 121,670,253 E489G probably damaging Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp941 C T 7: 140,811,664 R594H probably damaging Het
Zfy1 T C Y: 725,983 D594G probably damaging Het
Other mutations in Ppcdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Ppcdc APN 9 57415140 missense probably benign 0.00
R1666:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R3684:Ppcdc UTSW 9 57421125 critical splice donor site probably null
R4223:Ppcdc UTSW 9 57414715 missense possibly damaging 0.91
R4821:Ppcdc UTSW 9 57434911 missense probably benign 0.00
R5121:Ppcdc UTSW 9 57421163 missense possibly damaging 0.56
R5236:Ppcdc UTSW 9 57414654 missense probably benign 0.00
R7034:Ppcdc UTSW 9 57415170 missense probably damaging 1.00
R7303:Ppcdc UTSW 9 57414675 missense probably benign
R7591:Ppcdc UTSW 9 57434979 missense probably damaging 1.00
R7835:Ppcdc UTSW 9 57420276 missense probably benign 0.02
R7918:Ppcdc UTSW 9 57420276 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACAGGGGAGCTACTCGATAGACC -3'
(R):5'- TCCTCATGCACATACTGAGAGGGAC -3'

Sequencing Primer
(F):5'- CGATAGACCCGAATCTCATGGTG -3'
(R):5'- ACTGGATTGGTGACCCCATTTC -3'
Posted On2013-11-08